Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SUV420H1-suppressor of variegation 4-20 homolog 1 (Drosophila) Gene
PTXBC002522
New product
Data sheet of SUV420H1-suppressor of variegation 4-20 homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUV420H1-suppressor of variegation 4-20 homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002522 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUV420H1 |
| Origin species: | Human |
| Product name: | SUV420H1-suppressor of variegation 4-20 homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC002522 |
| Gene id: | 51111 |
| Gene description: | suppressor of variegation 4-20 homolog 1 (Drosophila) |
| Synonyms: | histone-lysine N-methyltransferase SUV420H1; SUV420H1; CGI-85; CGI85; histone-lysine N-methyltransferase KMT5B; C630029K18Rik; lysine (K)-specific methyltransferase 5B; lysine N-methyltransferase 5B; lysine-specific methyltransferase 5B; su(var)4-20 homolog 1; suppressor of variegation 4-20 homolog 1; suv4-20h1; lysine methyltransferase 5B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggtgaatggcaggagaaatggaggcaagttgtctaatgaccatcagcagaatcaatcaaaattacagcacacggggaaggacaccctgaaggctggcaaaaatgcagtcgagaggaggtcgaacagatgtaatggtaactcgggatttgaaggacagagtcgctatgtaccatcctctggaatgtccgccaaggaactctgtgaaaatgatgacctagcaaccagtttggttcttgatccctatttaggttttcaaacacacaaaatgaatactagcgcctttccttcgaggagctcaaggcatttttcaaaatctgacagtttttctcacaacaaccctgtgagatttaggcctattaaaggaaggcaggaagaactaaaggaagtaattgaacgttttaagaaagatgaacacttggagaaagccttcaaatgtttgacttcaggcgaatgggcacggcactattttctcaacaagaataaaatgcaggagaaattattcaaagaacatgtatttatttatttgcgaatgtttgcaactgacagtggatttgaaatattgccatgtaatagatactcatcagaacaaaatggagccaaaatagttgcaacaaaagagtggaaacgaaatgacaaaatagaattactggtgggttgtattgccgaactttcagaaattgaggagaacatgctacttagacatggagaaaacgacttcagtgtcatgtactccacaaggaaaaactgtgctcaactctggctgggtcctgctgcgtttataaaccatgattgcagacctaattgtaagtttgtgtcaactggtcgagatacagcatgtgtgaaggctctaagagacattgaacctggagaagaaatttcttgttattatggagatgggttctttggagaaaataatgagttctgcgagtgttacacttgcgaaagacggggcactggtgcttttaaatccagagtgggactgcctgcgcctgctcctgttatcaatagcaaatatggactcagagaaacagataaacgtttaaataggcttaaaaagttaggtgacagcagcaaaaattcagacagtcaatctgtcagctctaacactgatgcagataccactcaggaaaaaaacaatgcaagtaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DP beta 1 - ATPase, H+ transporting, lysosomal accessory protein 1 - papillary renal cell carcinoma (translocation-associated) - ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |