Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004892 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RCN2 |
| Origin species: | Human |
| Product name: | RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene |
| Size: | 2ug |
| Accessions: | BC004892 |
| Gene id: | 5955 |
| Gene description: | reticulocalbin 2, EF-hand calcium binding domain |
| Synonyms: | E6BP; ERC-55; ERC55; TCBP49; reticulocalbin-2; E6-binding protein; calcium-binding protein ERC-55; reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD); reticulocalbin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggccacgaagagcagcaaaaaagactgcaggcgatcataaagaaaatcgacttggactcagatggctttctcactgaaagtgaactcagttcatggattcagatgtcttttaagcattatgctatgcaagaagcaaaacaacagtttgttgaatatgataaaaacagtgatgatactgtgacttgggatgaatataacattcagatgtatgatcgtgtgattgactttgatgagaacactgctctggatgatgcagaagaggagtcctttaggaagcttcacttaaaggacaagaagcgatttgaaaaagctaaccaggattcaggtcccggtttgagtcttgaagaatttattgcttttgagcatcctgaagaagttgattatatgacggaatttgtcattcaagaagctttagaagaacatgacaaaaatggtgatggatttgttagtttggaagaatttcttggtgattacaggtgggatccaactgcaaatgaagatccagaatggatacttgttgagaaagacagattcgtgaatgattatgacaaagataacgatggcaggcttgatccccaagagctgttaccttgggtagtacctaataatcagggcattgcacaagaggaggcacttcatctaattgatgaaatggatttgaatggtgacaaaaagctctctgaagaagagattctggaaaacccggacttgtttctcaccagtgaagccacagattatggcagacagctccatgatgactatttctatcatgatgagctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromogranin A (parathyroid secretory protein 1) - transcription elongation factor A (SII)-like 1 - catenin (cadherin-associated protein), delta 1 - inhibitor of growth family, X-linked, pseudogene |