RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene View larger

RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene

PTXBC004892

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004892
Product type: DNA & cDNA
Ncbi symbol: RCN2
Origin species: Human
Product name: RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene
Size: 2ug
Accessions: BC004892
Gene id: 5955
Gene description: reticulocalbin 2, EF-hand calcium binding domain
Synonyms: E6BP; ERC-55; ERC55; TCBP49; reticulocalbin-2; E6-binding protein; calcium-binding protein ERC-55; reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD); reticulocalbin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggccacgaagagcagcaaaaaagactgcaggcgatcataaagaaaatcgacttggactcagatggctttctcactgaaagtgaactcagttcatggattcagatgtcttttaagcattatgctatgcaagaagcaaaacaacagtttgttgaatatgataaaaacagtgatgatactgtgacttgggatgaatataacattcagatgtatgatcgtgtgattgactttgatgagaacactgctctggatgatgcagaagaggagtcctttaggaagcttcacttaaaggacaagaagcgatttgaaaaagctaaccaggattcaggtcccggtttgagtcttgaagaatttattgcttttgagcatcctgaagaagttgattatatgacggaatttgtcattcaagaagctttagaagaacatgacaaaaatggtgatggatttgttagtttggaagaatttcttggtgattacaggtgggatccaactgcaaatgaagatccagaatggatacttgttgagaaagacagattcgtgaatgattatgacaaagataacgatggcaggcttgatccccaagagctgttaccttgggtagtacctaataatcagggcattgcacaagaggaggcacttcatctaattgatgaaatggatttgaatggtgacaaaaagctctctgaagaagagattctggaaaacccggacttgtttctcaccagtgaagccacagattatggcagacagctccatgatgactatttctatcatgatgagctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromogranin A (parathyroid secretory protein 1)
- transcription elongation factor A (SII)-like 1
- catenin (cadherin-associated protein), delta 1
- inhibitor of growth family, X-linked, pseudogene

Buy RCN2-reticulocalbin 2, EF-hand calcium binding domain Gene now

Add to cart