Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of INGX-inhibitor of growth family, X-linked, pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INGX-inhibitor of growth family, X-linked, pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101124 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INGX |
| Origin species: | Human |
| Product name: | INGX-inhibitor of growth family, X-linked, pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC101124 |
| Gene id: | 27160 |
| Gene description: | inhibitor of growth family, X-linked, pseudogene |
| Synonyms: | ING1L; p33ING2; inhibitor of growth protein 2; ING1Lp; inhibitor of growth 1-like protein; p32; inhibitor of growth family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccgctgcgacaacgaatgccccatcgagtggttccgcttctcgtgtgtgagtctcaaccataaaccaaagcgcaagtggtactgttccagatgccggggaaagaacgatgggcaaagcccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 6G, cGMP-specific, rod, gamma - aldo-keto reductase family 1, member C-like 1 - ribonuclease, RNase A family, 12 (non-active) - family with sequence similarity 150, member A |