Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RNASE12-ribonuclease, RNase A family, 12 (non-active) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNASE12-ribonuclease, RNase A family, 12 (non-active) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130347 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNASE12 |
| Origin species: | Human |
| Product name: | RNASE12-ribonuclease, RNase A family, 12 (non-active) Gene |
| Size: | 2ug |
| Accessions: | BC130347 |
| Gene id: | 493901 |
| Gene description: | ribonuclease, RNase A family, 12 (non-active) |
| Synonyms: | HEL-S-85p; RAI1; epididymis secretory sperm binding protein Li 85p; ribonuclease A I1; ribonuclease, RNase A family, 12 (non-active); ribonuclease-like protein 12; ribonuclease A family member 12 (inactive) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgataataatggtgataattttcttggtgcttctgttctgggaaaatgaggtgaatgatgaagcagtgatgtcaactttagaacacttgcatgtggactaccctcagaatgacgttcccgttcctgcaaggtactgcaaccacatgatcatacaaagagttatcagggaacctgaccacacttgtaaaaaggagcatgtcttcatccatgagaggcctcgaaaaatcaatggtatttgcatttctcccaagaaggttgcttgccaaaacctttcggccattttctgctttcagagtgagacaaagttcaaaatgacagtctgtcagctcattgaaggcacaagataccctgcctgcaggtaccactattcccccacagaggggtttgttcttgtcacttgtgatgacttgaggccagatagtttccttggctatgttaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 150, member A - family with sequence similarity 106, member A - family with sequence similarity 167, member A - cerebellar degeneration-related protein 1, 34kDa |