Login to display prices
Login to display prices
CHGA-chromogranin A (parathyroid secretory protein 1) Gene View larger

CHGA-chromogranin A (parathyroid secretory protein 1) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHGA-chromogranin A (parathyroid secretory protein 1) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHGA-chromogranin A (parathyroid secretory protein 1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001059
Product type: DNA & cDNA
Ncbi symbol: CHGA
Origin species: Human
Product name: CHGA-chromogranin A (parathyroid secretory protein 1) Gene
Size: 2ug
Accessions: BC001059
Gene id: 1113
Gene description: chromogranin A (parathyroid secretory protein 1)
Synonyms: CGA; chromogranin-A; SP-I; betagranin (N-terminal fragment of chromogranin A); catestatin; chromofungin; parathyroid secretory protein 1; pituitary secretory protein I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgctccgccgctgtcctggctcttctgctctgcgccgggcaagtcactgcgctccctgtgaacagccctatgaataaaggggataccgaggtgatgaaatgcatcgttgaggtcatctccgacacactttccaagcccagccccatgcctgtcagccaggaatgttttgagacactccgaggagatgaacggatcctttccattctgagacatcagaatttactgaaggagctccaagacctcgctctccaaggcgccaaggagagggcacatcagcagaagaaacacagcggttttgaagatgaactctcagaggttcttgagaaccagagcagccaggccgagctgaaagaggcggtggaagagccatcatccaaggatgttatggagaaaagagaggattccaaggaggcagagaaaagtggtgaagccacagacggagccaggccccaggccctcccggagcccatgcaggagtccaaggctgaggggaacaatcaggcccctggggaggaagaggaggaggaggaggaggccaccaacacccaccctccagccagcctccccagccagaaatacccaggcccacaggccgagggggacagtgagggcctctctcagggtctggtggacagagagaagggcctgagtgcagagccagggtggcaggcaaagagagaagaggaggaggaggaggaggaggaggctgaggctggagaggaggctgtccccgaggaagaaggccccactgtagtgctgaacccccacccgagccttggctacaaggagatccggaaaggcgagagtcggtcggaggctctggctgtggatggagctgggaagcctggggctgaggaggctcaggaccccgaagggaagggagaacaggagcactcccagcagaaagaggaggaggaggagatggcagtggtcccgcaaggcctcttccggggtgggaagagcggagagctggagcaggaggaggagcggctctccaaggagtgggaggactccaaacgctggagcaagatggaccagctggccaaggagctgacggctgagaagcggctggaggggcaggaggaggaggaggacaaccgggacagttccatgaagctctccttccgggcccgggcctacggcttcaggggccctgggccgcagctgcgacgaggctggaggccatcctcccgggaggacagccttgaggcgggcctgcccctccaggtccgaggctaccccgaggagaagaaagaggaggagggcagcgcaaaccgcagaccagaggaccaggagctggagagcctgtcggccattgaggcagagctggagaaagtggcccaccagctgcaggcactacggcggggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription elongation factor A (SII)-like 1
- catenin (cadherin-associated protein), delta 1
- inhibitor of growth family, X-linked, pseudogene
- phosphodiesterase 6G, cGMP-specific, rod, gamma