Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TCEAL1-transcription elongation factor A (SII)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TCEAL1-transcription elongation factor A (SII)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TCEAL1 |
| Origin species: | Human |
| Product name: | TCEAL1-transcription elongation factor A (SII)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC000809 |
| Gene id: | 9338 |
| Gene description: | transcription elongation factor A (SII)-like 1 |
| Synonyms: | SIIR; WEX9; p21; pp21; transcription elongation factor A protein-like 1; TCEA-like protein 1; nuclear phosphoprotein p21/SIIR; transcription elongation factor A (SII)-like 1; transcription elongation factor S-II protein-like 1; transcription elongation factor A like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaaaccacgcaaagaaaatgaagaagagccgcagagcgcgcccaagaccgatgaggagaggcctccggtggagcactctcccgaaaagcagtcccccgaggagcagtcttcggaggagcagtcctcggaggaggagttctttcctgaggagctcttgcctgagctcctgcctgagatgctcctctcggaggagcgccctccgcaggagggtctttccaggaaggacctgtttgaggggcgccctcccatggagcagcctccttgtggagtaggaaaacataagcttgaagaaggaagctttaaagaaaggttggctcgttctcgcccgcaatttagaggggacatacatggcagaaatttaagcaatgaggagatgatacaggcagcagatgagctagaagagatgaaaagagtaagaaacaaactgatgataatgcactggaaggcaaaacggagccgtccttatcctatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - catenin (cadherin-associated protein), delta 1 - inhibitor of growth family, X-linked, pseudogene - phosphodiesterase 6G, cGMP-specific, rod, gamma - aldo-keto reductase family 1, member C-like 1 |