FUCA1-fucosidase, alpha-L- 1, tissue Gene View larger

FUCA1-fucosidase, alpha-L- 1, tissue Gene

PTXBC017338

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUCA1-fucosidase, alpha-L- 1, tissue Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUCA1-fucosidase, alpha-L- 1, tissue Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017338
Product type: DNA & cDNA
Ncbi symbol: FUCA1
Origin species: Human
Product name: FUCA1-fucosidase, alpha-L- 1, tissue Gene
Size: 2ug
Accessions: BC017338
Gene id: 2517
Gene description: fucosidase, alpha-L- 1, tissue
Synonyms: FUCA; tissue alpha-L-fucosidase; alpha-L-fucosidase 1; alpha-L-fucosidase I; alpha-L-fucoside fucohydrolase 1; fucosidase, alpha-L- 1, tissue
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggtcgcggccggcgggtcccgcgctgttgctgctgctgctcttcctcggagcggccgagtcggtgcgtcgggcccagcctccgcgccgctacaccccagactggccgagcctggattctcggccgctgccggcctggttcgacgaagccaagttcggggtgttcatccactggggcgtgttctcggtgcccgcctggggcagcgagtggttctggtggcactggcagggcgaggggcggccgcagtaccagcgcttcatgcgcgacaactacccgcccggcttcagctacgccgacttcggaccgcagttcactgcgcgcttcttccacccggaggagtgggccgacctcttccaggccgcgggcgccaagtatgtagttttgacgacaaagcatcacgaaggcttcacaaactggccgagtcctgtgtcttggaactggaactccaaagacgtggggcctcatcgggatttggttggtgaattgggaacagctctccggaagaggaacatccgctatggactataccactcactcttagagtggttccatccactctatctacttgataagaaaaatggcttcaaaacacagcattttgtcagtgcaaaaacaatgccagagctgtacgaccttgttaacagctataaacctgatctgatctggtctgatggggagtgggaatgtcctgatacttactggaactccacaaattttctttcatggctctacaatgacagccctgtcaaggatgaggtggtagtaaatgaccgatggggtcagaactgttcctgtcaccatggaggatactataactgtgaagataaattcaagccacagagcttgccagatcacaagtgggagatgtgcaccagcattgacaagttttcctggggctatcgtcgtgacatggcattgtctgatgttacagaagaatctgaaatcatttcggaactggttcagacagtaagtttgggaggcaactatcttctgaacattggaccaactaaagatggactgattgttcccatcttccaagaaaggcttcttgctgttgggaaatggctgagcatcaatggggaggctatctatgcctccaaaccatggcgggtgcaatgggaaaagaacacaacatctgtatggtatacctcaaagggatcggctgtttatgccatttttctgcactggccagaaaatggagtcttaaaccttgaatcccccataactacctcaactacaaagataacaatgctgggaattcaaggagatctgaagtggtccacagatccagataaaggtctcttcatctctctaccccagttgccaccctctgctgtccccgcagagtttgcttggactataaagctgacaggagtgaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carboxypeptidase A3 (mast cell)
- phosphatidylserine synthase 2
- interleukin 10 receptor, beta
- PDZK1 interacting protein 1

Buy FUCA1-fucosidase, alpha-L- 1, tissue Gene now

Add to cart