Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PDZK1IP1-PDZK1 interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDZK1IP1-PDZK1 interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012303 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDZK1IP1 |
| Origin species: | Human |
| Product name: | PDZK1IP1-PDZK1 interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC012303 |
| Gene id: | 10158 |
| Gene description: | PDZK1 interacting protein 1 |
| Synonyms: | DD96; MAP17; SPAP; PDZK1-interacting protein 1; 17 kDa membrane-associated protein; epithelial protein up-regulated in carcinoma, membrane associated protein 17; membrane-associated protein 17; PDZK1 interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggccctcagcctcctcattctgggcctgctcatggcagtgccacctgccagctgtcagcaaggcctggggaaccttcagccctggatgcagggccttatcgcggtggccgtgttcctggtcctcgttgcaatcgcctttgcagtcaaacacttctggtgccaggaggagccggagcctgcacacatgatcctgaccgtcggaaacaaggcagatggagtcctggtgggaacagatggaaggtactcttcgatggcggccagtttcaggtccagtgagcatgagaatgcctatgagaatgtgcccgaggaggaaggcaaggtccgcagcaccccgatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - K(lysine) acetyltransferase 2A - non-protein coding RNA 29 - metallothionein 1 pseudogene 3 - Wilms tumor upstream neighbor 1 |