Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL10RB-interleukin 10 receptor, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL10RB-interleukin 10 receptor, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001903 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL10RB |
| Origin species: | Human |
| Product name: | IL10RB-interleukin 10 receptor, beta Gene |
| Size: | 2ug |
| Accessions: | BC001903 |
| Gene id: | 3588 |
| Gene description: | interleukin 10 receptor, beta |
| Synonyms: | CDW210B; CRF2-4; CRFB4; D21S58; D21S66; IL-10R2; interleukin-10 receptor subunit beta; IL-10 receptor subunit beta; IL-10R subunit 2; IL-10R subunit beta; IL-10RB; cytokine receptor class-II CRF2-4; cytokine receptor class-II member 4; cytokine receptor family 2 member 4; cytokine receptor family II, member 4; interleukin 10 receptor, beta; interleukin-10 receptor subunit 2; interleukin 10 receptor subunit beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtggagccttgggagctggctgggtggctgcctgctggtgtcagcattgggaatggtaccacctcccgaaaatgtcagaatgaattctgttaatttcaagaacattctacagtgggagtcacctgcttttgccaaagggaacctgactttcacagctcagtacctaagttataggatattccaagataaatgcatgaatactaccttgacggaatgtgatttctcaagtctttccaagtatggtgaccacaccttgagagtcagggctgaatttgcagatgagcattcagactgggtaaacatcaccttctgtcctgtggatgacaccattattggaccccctggaatgcaagtagaagtacttgctgattctttacatatgcgtttcttagcccctaaaattgagaatgaatacgaaacttggactatgaagaatgtgtataactcatggacttataatgtgcaatactggaaaaacggtactgatgaaaagtttcaaattactccccagtatgactttgaggtcctcagaaacctggagccatggacaacttattgtgttcaagttcgagggtttcttcctgatcggaacaaagctggggaatggagtgagcctgtctgtgagcaaacaacccatgacgaaacggtcccctcctggatggtggccgtcatcctcatggcctcggtcttcatggtctgcctggcactcctcggctgcttcgccttgctgtggtgcgtttacaagaagacaaagtacgccttctcccctaggaattctcttccacagcacctgaaagagtttttgggccatcctcatcataacacacttctgtttttctcctttccattgtcggatgagaatgatgtttttgacaagctaagtgtcattgcagaagactctgagagcggcaagcagaatcctggtgacagctgcagcctcgggaccccgcctgggcaggggccccaaagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PDZK1 interacting protein 1 - K(lysine) acetyltransferase 2A - non-protein coding RNA 29 - metallothionein 1 pseudogene 3 |