CPA3-carboxypeptidase A3 (mast cell) Gene View larger

CPA3-carboxypeptidase A3 (mast cell) Gene

PTXBC012613

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPA3-carboxypeptidase A3 (mast cell) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPA3-carboxypeptidase A3 (mast cell) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012613
Product type: DNA & cDNA
Ncbi symbol: CPA3
Origin species: Human
Product name: CPA3-carboxypeptidase A3 (mast cell) Gene
Size: 2ug
Accessions: BC012613
Gene id: 1359
Gene description: carboxypeptidase A3 (mast cell)
Synonyms: MC-CPA; mast cell carboxypeptidase A; carboxypeptidase A3 (mast cell); tissue carboxypeptidase A; carboxypeptidase A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctcatcctgcctgtgggtttgattgctaccactcttgcaattgctcctgtccgctttgacagggagaaggtgttccgcgtgaagccccaggatgaaaaacaagcagacatcataaaggacttggccaaaaccaatgagcttgacttctggtatccaggtgccacccaccacgtagctgctaaaatgatggtggatttccgagttagtgagaaggaatcccaagccatccagtctgccttggatcaaaataaaatgcactatgaaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaagaagatatcccaggcaggcacagctacgcaaaatacaataattgggaaaagattgtggcttggactgaaaagatgatggataagtatcctgaaatggtctctcgtattaaaattggatctactgttgaagataatccactatatgttctgaagattggggaaaagaatgaaagaagaaaggctatttttatggattgtggcattcacgcacgagaatgggtctccccagcattctgccagtggtttgtctatcaggcaaccaaaacttatgggagaaacaaaattatgaccaaactcttggaccgaatgaatttttacattcttcctgtgttcaatgttgatggatatatttggtcatggacaaagaaccgcatgtggagaaaaaatcgttccaagaaccaaaactccaaatgcatcggcactgacctcaacaggaattttaatgcttcatggaactccattcctaacaccaatgacccatgtgcagataactatcggggctctgcaccagagtccgagaaagagacgaaagctgtcactaatttcattagaagccacctgaatgaaatcaaggtttacatcaccttccattcctactcccagatgctattgtttccctatggatatacatcaaaactgccacctaaccatgaggacttggccaaagttgcaaagattggcactgatgttctatcaactcgatatgaaacccgctacatctatggcccaatagaatcaacaatttacccgatatcaggttcttctttagactgggcttatgacctgggcatcaaacacacatttgcctttgagctccgagataaaggcaaatttggttttctccttccagaatcccggataaagccaacgtgcagagagaccatgctagctgtcaaatttattgccaagtatatcctcaagcatacttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylserine synthase 2
- interleukin 10 receptor, beta
- PDZK1 interacting protein 1
- K(lysine) acetyltransferase 2A

Buy CPA3-carboxypeptidase A3 (mast cell) Gene now

Add to cart