EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene View larger

EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006318
Product type: DNA & cDNA
Ncbi symbol: EPB49
Origin species: Human
Product name: EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene
Size: 2ug
Accessions: BC006318
Gene id: 2039
Gene description: erythrocyte membrane protein band 4.9 (dematin)
Synonyms: EPB49; DMT; dematin; erythrocyte membrane protein band 4.9 (dematin); dematin actin binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacggctgcagaagcaaccacttacctcccccgggagcgtgagcccctcccgagattccagtgtgcctggctctccctccagcatcgtggccaagatggacaatcaggtgctgggctacaaggacctggctgccatccccaaggacaaggccatcctggacatcgagcggcccgacctcatgatctacgagcctcacttcacttattccctcctggaacacgtggagctgcctcgcagccgcgagcgctcgctgtcacccaaatccacatcccccccaccatccccagaggtgtgggcggacagccggtcgcctggaatcatctctcaggcctcggcccccagaaccactggaaccccccggaccagcctgccccatttccaccaccctgagacctcccgcccagattccaacatctacaagaagcctcccatctataagcagagagagtccgtgggaggcagccctcagaccaagcacctcatcgaggatctcatcatcgagtcatccaagtttcctgcagcccagcccccagaccccaaccagccagccaaaatcgaaaccgactactggccatgccccccgtctctggctgttgtggagacagaatggaggaagcggaaggcgtctcggaggggagcagaggaagaggaggaggaggaagatgacgactctggagaggagatgaaggctctcagggagcgtcagagagaggaactcagtaaggttacttccaacttgggaaagatgatcttgaaagaagagatggaaaagtcattgccgatccgaaggaaaacccgctctctgcctgaccggacacccttccatacctccttgcaccagggaacgtctaaatcttcctctctccccgcctatggcaggaccaccctgagccggctacagtccacagagttcagcccatcagggagtgagactggaagcccaggcctgcagaacggagagggccagagggggaggatggaccgggggaactccctgccctgtgtgctggagcagaagatctatccctatgaaatgctagtggtgaccaacaaggggcgaaccaagctgccaccgggggtggatcggatgcggcttgagaggcatctgtctgccgaggacttctcaagggtatttgccatgtcccctgaagagtttggcaagctggctctgtggaagcggaatgagctcaagaagaaggcctctctcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 126, member A
- reticulocalbin 2, EF-hand calcium binding domain
- chromogranin A (parathyroid secretory protein 1)
- transcription elongation factor A (SII)-like 1

Buy EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene now

Add to cart