CDK5RAP3-CDK5 regulatory subunit associated protein 3 Gene View larger

CDK5RAP3-CDK5 regulatory subunit associated protein 3 Gene

PTXBC009957

New product

Data sheet of CDK5RAP3-CDK5 regulatory subunit associated protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDK5RAP3-CDK5 regulatory subunit associated protein 3 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC009957
Product type: DNA & cDNA
Ncbi symbol: CDK5RAP3
Origin species: Human
Product name: CDK5RAP3-CDK5 regulatory subunit associated protein 3 Gene
Size: 2ug
Accessions: BC009957
Gene id: 80279
Gene description: CDK5 regulatory subunit associated protein 3
Synonyms: C53; HSF-27; IC53; LZAP; MST016; OK/SW-cl.114; PP1553; CDK5 regulatory subunit-associated protein 3; CDK5 regulatory subunit associated protein IC53-2; LXXLL/leucine-zipper-containing ARF-binding protein; LXXLL/leucine-zipper-containing ARFbinding protein; ischemic heart CDK5 activator-binding protein C53; CDK5 regulatory subunit associated protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaccatcagcacgtgcccatcgacatccagaccagcaagctgctcgattggctggtggacagaaggcactgcagcctgaaatggcagagtctggtgctgacgatccgcgagaagatcaatgctgccatccaggacatgccagagagcgaagagatcgcccagctgctgtctgggtcctacattcactactttcactgcctaagaatcctggaccttctcaaaggcacagaggcctccacgaagaatatttttggccgatactcttcacagcggatgaaggattggcaggagattatagctctgtatgagaaggacaacacctacttagtggaactctctagcctcctggttcggaatgtcaactatgagatcccctcactgaagaagcagattgccaagtgccagcagctgcagcaagaatacagccgcaaggaggaggagtgccaggcaggggctgccgagatgcgggagcagttctaccactcctgcaagcagtatggcatcacgggcgaaaatgtccgaggagaactgctggccctggtgaaggacctgccgagtcagctggctgagattggggcagcggctcagcagtccctgggggaagccattgacgtgtaccaggcgtctgtggggtttgtgtgtgagagccccacagagcaggtgttgccaatgctgcggttcgtgcagaagcggggaaactcaacggtgtacgagtggaggacagggacagagccctctgtggtggaacgaccccacctcgaggagcttcctgagcaggtggcagaagatgcgattgactggggcgactttggggtagaggcagtgtctgaggggactgactctggcatctctgccgaggctgctggaatcgactggggcatcttcccggaatcagattcaaaggatcctggaggtgatgggatagactggggagacgatgctgttgctttgcagatcacagtgctggaagcaggaacccaggctccagaaggtgttgccaggggcccagatgccctgacactgcttgaatacactgagacccggaatcagttccttgatgagctcatggagcttgagatcttcttagcccagagagcagtggagttgagtgaggaggcagatgtcctgtctgtgagccagttccagctggctccagccatcctgcagggccagaccaaagagaagatggttaccatggtgtcagtgctggaggatctgattggcaagcttaccagtcttcagctgcaacacctgtttatgatcctggcctcaccaaggtatgtggaccgagtgactgaattcctccagcaaaagctgaagcagtcccagctgctggctttgaagaaagagctgatggtgcagaagcagcaggaggcacttgaggagcaggcggctctggagcctaagctggacctgctactggagaagaccaaggagctgcagaagctgattgaagctgacatctccaagaggtacagcgggcgccctgtgaacctgatgggaacctctctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - erythrocyte membrane protein band 4.9 (dematin)
- family with sequence similarity 126, member A
- reticulocalbin 2, EF-hand calcium binding domain
- chromogranin A (parathyroid secretory protein 1)

Buy CDK5RAP3-CDK5 regulatory subunit associated protein 3 Gene now

Add to cart