Login to display prices
Login to display prices
CDR2-cerebellar degeneration-related protein 2, 62kDa Gene View larger

CDR2-cerebellar degeneration-related protein 2, 62kDa Gene

PTXBC017503

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDR2-cerebellar degeneration-related protein 2, 62kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDR2-cerebellar degeneration-related protein 2, 62kDa Gene

Proteogenix catalog: PTXBC017503
Ncbi symbol: CDR2
Product name: CDR2-cerebellar degeneration-related protein 2, 62kDa Gene
Size: 2ug
Accessions: BC017503
Gene id: 1039
Gene description: cerebellar degeneration-related protein 2, 62kDa
Synonyms: CDR62; cerebellar degeneration-related protein 2; Yo paraneoplastic antigen; cerebellar degeneration-related protein 2, 62kDa; major Yo paraneoplastic antigen; paraneoplastic cerebellar degeneration-associated antigen; cerebellar degeneration related protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggaggacgagccgtggtacgaccaccaggacctccagcaagatcttcaacttgctgctgagcttgggaagacattactggatcggaacacagagttggaggactctgttcagcagatgtatacaaccaatcaggagcagttacaggaaattgagtatctgacgaagcaagtggaacttctacggcagatgaacgaacaacatgcaaaggtttatgaacaattagacgtcacagcaagggaactggaagaaacaaatcaaaagctagttgctgacagcaaggcctcacagcaaaagattctgagcctgactgaaacgattgaatgcctgcaaaccaacattgatcacctccagagccaagtggaggagctgaagtcatctggccaagggagaaggagcccgggaaagtgtgaccaggagaaaccggcacccagctttgcatgtctgaaggagctgtatgacctccgccaacacttcgtgtatgatcatgtgttcgctgagaagatcacttccttgcaaggtcagccaagccctgatgaagaggaaaatgagcacttgaaaaaaacagtgacaatgttgcaggcccagctgagcctggagcggcagaagcgggtgactatggaggaggaatatgggctcgtgttaaaggagaacagtgaactggagcagcagctgggggccacaggtgcctaccgagcacgggcgctggaactagaggccgaggtggcagagatgcgacagatgttgcagtcagagcatccatttgtgaatggagttgagaagctggtgccagactctctgtatgttcctttcaaagagcccagccagagcctgctggaagagatgttcctgactgtgccggaatcacatagaaagcctctcaagcgcagcagcagtgagacgatcctcagcagcttggcagggagtgacatcgtgaagggccacgaggagacctgcatcaggagggccaaggctgtgaaacagaggggcatctcccttctgcacgaagtggacacgcagtacagcgccctgaaggtgaagtatgaagagttgctgaagaagtgccaagaggaacaggactccctgtcacacaaggctgtgcagacctccagggctgcagccaaggacctgactggagtgaacgcccagtctgagcctgttgccagcggctgggaactggcctctgtcaacccagagcccgtgagttcccctacaacacctccagaatacaaagcgttgtttaaggagatctttagttgcatcaagaaaactaagcaggaaatagatgaacagagaacaaaataccgatcactctcctctcattcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: