CDR2-cerebellar degeneration-related protein 2, 62kDa Gene View larger

CDR2-cerebellar degeneration-related protein 2, 62kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDR2-cerebellar degeneration-related protein 2, 62kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDR2-cerebellar degeneration-related protein 2, 62kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017503
Product type: DNA & cDNA
Ncbi symbol: CDR2
Origin species: Human
Product name: CDR2-cerebellar degeneration-related protein 2, 62kDa Gene
Size: 2ug
Accessions: BC017503
Gene id: 1039
Gene description: cerebellar degeneration-related protein 2, 62kDa
Synonyms: CDR62; cerebellar degeneration-related protein 2; Yo paraneoplastic antigen; cerebellar degeneration-related protein 2, 62kDa; major Yo paraneoplastic antigen; paraneoplastic cerebellar degeneration-associated antigen; cerebellar degeneration related protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggaggacgagccgtggtacgaccaccaggacctccagcaagatcttcaacttgctgctgagcttgggaagacattactggatcggaacacagagttggaggactctgttcagcagatgtatacaaccaatcaggagcagttacaggaaattgagtatctgacgaagcaagtggaacttctacggcagatgaacgaacaacatgcaaaggtttatgaacaattagacgtcacagcaagggaactggaagaaacaaatcaaaagctagttgctgacagcaaggcctcacagcaaaagattctgagcctgactgaaacgattgaatgcctgcaaaccaacattgatcacctccagagccaagtggaggagctgaagtcatctggccaagggagaaggagcccgggaaagtgtgaccaggagaaaccggcacccagctttgcatgtctgaaggagctgtatgacctccgccaacacttcgtgtatgatcatgtgttcgctgagaagatcacttccttgcaaggtcagccaagccctgatgaagaggaaaatgagcacttgaaaaaaacagtgacaatgttgcaggcccagctgagcctggagcggcagaagcgggtgactatggaggaggaatatgggctcgtgttaaaggagaacagtgaactggagcagcagctgggggccacaggtgcctaccgagcacgggcgctggaactagaggccgaggtggcagagatgcgacagatgttgcagtcagagcatccatttgtgaatggagttgagaagctggtgccagactctctgtatgttcctttcaaagagcccagccagagcctgctggaagagatgttcctgactgtgccggaatcacatagaaagcctctcaagcgcagcagcagtgagacgatcctcagcagcttggcagggagtgacatcgtgaagggccacgaggagacctgcatcaggagggccaaggctgtgaaacagaggggcatctcccttctgcacgaagtggacacgcagtacagcgccctgaaggtgaagtatgaagagttgctgaagaagtgccaagaggaacaggactccctgtcacacaaggctgtgcagacctccagggctgcagccaaggacctgactggagtgaacgcccagtctgagcctgttgccagcggctgggaactggcctctgtcaacccagagcccgtgagttcccctacaacacctccagaatacaaagcgttgtttaaggagatctttagttgcatcaagaaaactaagcaggaaatagatgaacagagaacaaaataccgatcactctcctctcattcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDK5 regulatory subunit associated protein 3
- erythrocyte membrane protein band 4.9 (dematin)
- family with sequence similarity 126, member A
- reticulocalbin 2, EF-hand calcium binding domain

Buy CDR2-cerebellar degeneration-related protein 2, 62kDa Gene now

Add to cart