Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIK3R2-phosphoinositide-3-kinase, regulatory subunit 2 (beta) Gene
PTXBC014170
New product
Data sheet of PIK3R2-phosphoinositide-3-kinase, regulatory subunit 2 (beta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIK3R2-phosphoinositide-3-kinase, regulatory subunit 2 (beta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014170 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIK3R2 |
| Origin species: | Human |
| Product name: | PIK3R2-phosphoinositide-3-kinase, regulatory subunit 2 (beta) Gene |
| Size: | 2ug |
| Accessions: | BC014170 |
| Gene id: | 5296 |
| Gene description: | phosphoinositide-3-kinase, regulatory subunit 2 (beta) |
| Synonyms: | MPPH; MPPH1; P85B; p85; p85-BETA; phosphatidylinositol 3-kinase regulatory subunit beta; PI3-kinase subunit p85-beta; PI3K regulatory subunit beta; phosphatidylinositol 3-kinase 85 kDa regulatory subunit beta; phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta); phosphoinositide-3-kinase regulatory subunit beta; phosphoinositide-3-kinase, regulatory subunit 2 (beta); ptdIns-3-kinase regulatory subunit p85-beta; phosphoinositide-3-kinase regulatory subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcgtactgcaattgaggccttcaatgagactatcaagatctttgaagagcagggccagactcaagagaaatgcagcaaggaatacctggagcgcttccggcgtgagggcaacgagaaagagatgcaaaggatcctgctgaactccgagcggctcaagtcccgcattgccgagatccatgagagccgcacgaagctggagcagcagctgcgggcccaggcctcggacaacagagagatcgacaagcgcatgaacagcctcaagccggacctcatgcagctgcgcaagatccgagaccagtacctcgtgtggctcacccagaaaggcgcccggcagaagaaaatcaacgagtggctggggattaaaaatgagactgaggaccagtacgcactcatggaggacgaggacgatctcccgcaccacgaggaacgcacttggtacgtgggcaagatcaaccgcacgcaggcagaggagatgctgagcggcaagcgggatggcaccttcctcatccgcgagagcagccagcggggctgctacgcctgctccgtggtagtggacggcgacaccaagcactgcgtcatctaccgcacggccaccggcttcggcttcgcggagccctacaacctgtacgggtcgctgaaggagctggtgctgcactaccagcacgcctcgctggtgcagcacaacgacgcgctcaccgtcaccctggcgcacccagtgcgcgccccgggccccggcccgccgcctgccgcccgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - six transmembrane epithelial antigen of the prostate 1 - phosphatidylinositol glycan anchor biosynthesis, class F - X-prolyl aminopeptidase (aminopeptidase P) 1, soluble - nudE nuclear distribution gene E homolog 1 (A. nidulans) |