STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene View larger

STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene

PTXBC011802

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011802
Product type: DNA & cDNA
Ncbi symbol: STEAP1
Origin species: Human
Product name: STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene
Size: 2ug
Accessions: BC011802
Gene id: 26872
Gene description: six transmembrane epithelial antigen of the prostate 1
Synonyms: STEAP1 metalloreductase; metalloreductase STEAP1; PRSS24; STEAP; six transmembrane epithelial antigen of the prostate 1; six-transmembrane epithelial antigen of prostate 1; STEAP family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaagcagaaaagacatcacaaaccaagaagaactttggaaaatgaagcctaggagaaatttagaagaagacgattatttgcataaggacacgggagagaccagcatgctaaaaagacctgtgcttttgcatttgcaccaaacagcccatgctgatgaatttgactgcccttcagaacttcagcacacacaggaactctttccacagtggcacttgccaattaaaatagctgctattatagcatctctgacttttctttacactcttctgagggaagtaattcaccctttagcaacttcccatcaacaatatttttataaaattccaatcctggtcatcaacaaagtcttgccaatggtttccatcactctcttggcattggtttacctgccaggtgtgatagcagcaattgtccaacttcataatggaaccaagtataagaagtttccacattggttggataagtggatgttaacaagaaagcagtttgggcttctcagtttcttttttgctgtactgcatgcaatttatagtctgtcttacccaatgaggcgatcctacagatacaagttgctaaactgggcatatcaacaggtccaacaaaataaagaagatgcctggattgagcatgatgtttggagaatggagatttatgtgtctctgggaattgtgggattggcaatactggctctgttggctgtgacatctattccatctgtgagtgactctttgacatggagagaatttcactatattcagagcaagctaggaattgtttcccttctactgggcacaatacacgcattgatttttgcctggaataagtggatagatataaaacaatttgtatggtatacacctccaacttttatgatagctgttttccttccaattgttgtcctgatatttaaaagcatactattcctgccatgcttgaggaagaagatactgaagattagacatggttgggaagacgtcaccaaaattaacaaaactgagatatgttcccagttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol glycan anchor biosynthesis, class F
- X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
- nudE nuclear distribution gene E homolog 1 (A. nidulans)
- DIP2 disco-interacting protein 2 homolog A (Drosophila)

Buy STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene now

Add to cart