Login to display prices
Login to display prices
STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene View larger

STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene

PTXBC011802

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene

Proteogenix catalog: PTXBC011802
Ncbi symbol: STEAP1
Product name: STEAP1-six transmembrane epithelial antigen of the prostate 1 Gene
Size: 2ug
Accessions: BC011802
Gene id: 26872
Gene description: six transmembrane epithelial antigen of the prostate 1
Synonyms: STEAP1 metalloreductase; metalloreductase STEAP1; PRSS24; STEAP; six transmembrane epithelial antigen of the prostate 1; six-transmembrane epithelial antigen of prostate 1; STEAP family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaagcagaaaagacatcacaaaccaagaagaactttggaaaatgaagcctaggagaaatttagaagaagacgattatttgcataaggacacgggagagaccagcatgctaaaaagacctgtgcttttgcatttgcaccaaacagcccatgctgatgaatttgactgcccttcagaacttcagcacacacaggaactctttccacagtggcacttgccaattaaaatagctgctattatagcatctctgacttttctttacactcttctgagggaagtaattcaccctttagcaacttcccatcaacaatatttttataaaattccaatcctggtcatcaacaaagtcttgccaatggtttccatcactctcttggcattggtttacctgccaggtgtgatagcagcaattgtccaacttcataatggaaccaagtataagaagtttccacattggttggataagtggatgttaacaagaaagcagtttgggcttctcagtttcttttttgctgtactgcatgcaatttatagtctgtcttacccaatgaggcgatcctacagatacaagttgctaaactgggcatatcaacaggtccaacaaaataaagaagatgcctggattgagcatgatgtttggagaatggagatttatgtgtctctgggaattgtgggattggcaatactggctctgttggctgtgacatctattccatctgtgagtgactctttgacatggagagaatttcactatattcagagcaagctaggaattgtttcccttctactgggcacaatacacgcattgatttttgcctggaataagtggatagatataaaacaatttgtatggtatacacctccaacttttatgatagctgttttccttccaattgttgtcctgatatttaaaagcatactattcctgccatgcttgaggaagaagatactgaagattagacatggttgggaagacgtcaccaaaattaacaaaactgagatatgttcccagttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: