Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIGF-phosphatidylinositol glycan anchor biosynthesis, class F Gene
PTXBC021725
New product
Data sheet of PIGF-phosphatidylinositol glycan anchor biosynthesis, class F Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIGF-phosphatidylinositol glycan anchor biosynthesis, class F Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021725 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIGF |
| Origin species: | Human |
| Product name: | PIGF-phosphatidylinositol glycan anchor biosynthesis, class F Gene |
| Size: | 2ug |
| Accessions: | BC021725 |
| Gene id: | 5281 |
| Gene description: | phosphatidylinositol glycan anchor biosynthesis, class F |
| Synonyms: | phosphatidylinositol-glycan biosynthesis class F protein; GPI11 homolog; PIG-F; phosphatidylinositol glycan anchor biosynthesis class F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagataacgatatcaagagactactgtatacccatcttttatgcatattttcaattatcctaagtgtcttcattccatcactcttcttggagaacttctcaatattggaaacacacttgacatggttgtgcatctgttctggttttgtaactgctgtcaatctagtactatatttagtagtgaaaccaaatacatcctctaaaagaagttcattatcacacaaggtaactggatttttgaaatgctgtatctactttcttatgtcttgtttctcctttcatgtaatttttgttctgtatggagcaccactgatagagttggcgttggaaacatttttatttgcagttattttgtctacttttactactgtgccttgcttatgtttgttaggaccaaacctcaaagcatggctaagagtgttcagtagaaatggagttacatccatatgggagaatagtctccagatcactacaatttctagctttgtaggagcatggcttggagcacttcctattccactggattgggaaagaccatggcagatgacagtagaaagaaaacgtagcacttatagatctctccatgtaccctgcagggggcttggtactgtgaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-prolyl aminopeptidase (aminopeptidase P) 1, soluble - nudE nuclear distribution gene E homolog 1 (A. nidulans) - DIP2 disco-interacting protein 2 homolog A (Drosophila) - phosphatidylinositol glycan anchor biosynthesis, class G |