Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDE1-nudE nuclear distribution gene E homolog 1 (A. nidulans) Gene
PTXBC001421
New product
Data sheet of NDE1-nudE nuclear distribution gene E homolog 1 (A. nidulans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDE1-nudE nuclear distribution gene E homolog 1 (A. nidulans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001421 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDE1 |
| Origin species: | Human |
| Product name: | NDE1-nudE nuclear distribution gene E homolog 1 (A. nidulans) Gene |
| Size: | 2ug |
| Accessions: | BC001421 |
| Gene id: | 54820 |
| Gene description: | nudE nuclear distribution gene E homolog 1 (A. nidulans) |
| Synonyms: | HOM-TES-87; LIS4; MHAC; NDE; NUDE; NUDE1; nuclear distribution protein nudE homolog 1; LIS1-interacting protein NUDE1, rat homolog; nudE nuclear distribution E homolog 1; nudE nuclear distribution gene E homolog 1; nudE neurodevelopment protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggactccggaaagactttcagctccgaggaggaagaagctaactattggaaagatctggcgatgacctacaaacagagggcagaaaatacgcaagaggaactccgagaattccaggagggaagccgagaatatgaagctgaattggagacgcagctgcaacaaattgaaaccaggaacagagacctcctgtccgaaaataaccgccttcgcatggagctggaaaccatcaaggagaagtttgaagtgcagcactctgaaggctaccggcagatctcagccttggaggatgacctcgcgcagaccaaagccattaaagaccaattgcagaaatacatcagagagctggagcaagcaaatgacgacctggaaagagccaagcgcgccacgatcatgtctctcgaagactttgagcagcgcttgaatcaggccatcgaaagaaatgccttcctggaaagtgaacttgatgaaaaagagaatctcctggaatctgttcagagactgaaggatgaagccagagatttgcggcaggaactggccgtgcagcagaagcaggagaaacccaggacccccatgcccagctcagtggaagctgagaggacagacacagctgtgcaggccacgggctccgtgccgtccacgcccattgctcaccgaggacccagctcaagtttaaacacacctgggagcttcagacgtggcctggacgactccaccggggggacccccctcacacctgcggcccggatatcagccctcaacattgtgggagacctactgcggaaagtcggggcactggagtccaaactcgcttcctgccggaacctcgtgtacgatcagtccccaaaccgaacaggtggcccagcctctgggcggagcagcaagaacagagatggcggggagagacggccaagcagcaccagcgtgcctttgggtgataaggggttggacacgagttgccgctggttgtccaaatcaacaaccaggtcgtccagctcctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DIP2 disco-interacting protein 2 homolog A (Drosophila) - phosphatidylinositol glycan anchor biosynthesis, class G - SH3 domain binding glutamic acid-rich protein like 2 - potassium channel tetramerisation domain containing 11 |