Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SH3BGRL2-SH3 domain binding glutamic acid-rich protein like 2 Gene
PTXBC052987
New product
Data sheet of SH3BGRL2-SH3 domain binding glutamic acid-rich protein like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SH3BGRL2-SH3 domain binding glutamic acid-rich protein like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052987 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SH3BGRL2 |
| Origin species: | Human |
| Product name: | SH3BGRL2-SH3 domain binding glutamic acid-rich protein like 2 Gene |
| Size: | 2ug |
| Accessions: | BC052987 |
| Gene id: | 83699 |
| Gene description: | SH3 domain binding glutamic acid-rich protein like 2 |
| Synonyms: | SH3 domain-binding glutamic acid-rich-like protein 2; SH3 domain binding glutamic acid-rich protein like 2; fovea-associated SH3 domain-binding protein; SH3 domain binding glutamate rich protein like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcatccgcgtgttcatcgcctcttcctcgggcttcgtggcgataaagaagaagcagcaagatgtggttagatttctggaagccaacaagatagagtttgaggaggtggatatcacaatgtcagaagaacagaggcaatggatgtacaaaaacgtccccccggaaaagaaacccactcagggcaaccccctgccacctcagatatttaatggcgaccgatactgtggagattatgacagtttttttgaatccaaggaaagcaacacagtcttttcatttttaggcctgaaaccacggttggcatcaaaggcagaaccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium channel tetramerisation domain containing 11 - tumor necrosis factor (ligand) superfamily, member 11 - phosphoinositide-3-kinase, regulatory subunit 2 (beta) - transmembrane and tetratricopeptide repeat containing 3 |