Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
PTXBC012566
New product
Data sheet of NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012566 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NPM1 |
| Origin species: | Human |
| Product name: | NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene |
| Size: | 2ug |
| Accessions: | BC012566 |
| Gene id: | 4869 |
| Gene description: | nucleophosmin (nucleolar phosphoprotein B23, numatrin) |
| Synonyms: | B23; NPM; nucleophosmin; nucleolar protein NO38; nucleophosmin (nucleolar phosphoprotein B23, numatrin); nucleophosmin/nucleoplasmin family, member 1; testicular tissue protein Li 128 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagattcgatggacatggacatgagccccctgaggccccagaactatcttttcggttgtgaactaaaggccgacaaagattatcactttaaggtggataatgatgaaaatgagcaccagttatctttaagaacggtcagtttaggggctggtgcaaaggatgagttgcacattgttgaagcagaggcaatgaattacgaaggcagtccaattaaagtaacactggcaactttgaaaatgtctgtacagccaacggtttcccttgggggctttgaaataacaccaccagtggtcttaaggttgaagtgtggttcagggccagtgcatattagtggacagcacttagtagctgtggaggaagatgcagagtcagaagatgaagaggaggaggatgtgaaactcttaagtatatctggaaagcggtctgcccctggaggtggtagcaaggttccacagaaaaaagtaaaacttgctgctgatgaagatgatgacgatgatgatgaagaggatgatgatgaagatgatgatgatgatgattttgatgatgaggaagctgaagaaaaagcgccagtgaagaaatctatacgagatactccagccaaaaatgcacaaaagtcaaatcagaatggaaaagactcaaaaccatcatcaacaccaagatcaaaaggacaagaatccttcaagaaacaggaaaaaactcctaaaacaccaaaaggacctagttctgtagaagacattaaagcaaaaatgcaagcaagtatagaaaaaggtggttctcttcccaaagtggaagccaaattcatcaattatgtgaagaattgcttccggatgactgaccaagaggctattcaagatttctggcagtggaggaagtctctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 3, subunit M - potassium channel tetramerisation domain containing 5 - signaling threshold regulating transmembrane adaptor 1 - Ras association (RalGDS/AF-6) domain family member 1 |