Login to display prices
Login to display prices
EIF3M-eukaryotic translation initiation factor 3, subunit M Gene View larger

EIF3M-eukaryotic translation initiation factor 3, subunit M Gene

PTXBC019103

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3M-eukaryotic translation initiation factor 3, subunit M Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3M-eukaryotic translation initiation factor 3, subunit M Gene

Proteogenix catalog: PTXBC019103
Ncbi symbol: EIF3M
Product name: EIF3M-eukaryotic translation initiation factor 3, subunit M Gene
Size: 2ug
Accessions: BC019103
Gene id: 10480
Gene description: eukaryotic translation initiation factor 3, subunit M
Synonyms: GA17; PCID1; TANGO7; hfl-B5; eukaryotic translation initiation factor 3 subunit M; PCI domain containing 1 (herpesvirus entry mediator); PCI domain-containing protein 1; dendritic cell protein; fetal lung protein B5; transport and golgi organization 7 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgtcccggccttcatcgacatcagtgaagaagatcaggctgctgagcttcgtgcttatctgaaatctaaaggagctgagatttcagaagagaactcggaaggtggacttcatgttgatttagctcaaattattgaagcctgtgatgtgtgtctgaaggaggatgataaagatgttgaaagtgtgatgaacagtgtggtatccctactcttgatcctggaaccagacaagcaagaagctttgattgaaagcctatgtgaaaagctggtcaaatttcgcgaaggtgaacgcccgtctctgagactgcagttgttaagcaaccttttccacgggatggataagaatactcctgtaagatacacagtgtattgcagccttattaaagtggcagcatcttgtggggccatccagtacatcccaactgagctggatcaagttagaaaatggatttctgactggaatctcaccactgaaaaaaagcacacccttttaagactactttatgaggcacttgtggattgtaagaagagtgatgctgcttcaaaagtcatggtggaattgctcggaagttacacagaggacaatgcttcccaggctcgagttgatgcccacaggtgtattgtacgagcattgaaagatccaaatgcatttctttttgaccaccttcttactttaaaaccagtcaagtttttggaaggcgagcttattcatgatcttttaaccatttttgtgagtgctaaattggcatcatatgtcaagttttatcagaataataaagacttcattgattcacttggcctgttacatgaacagaatatggcaaaaatgagactacttacttttatgggaatggcagtagaaaataaggaaatttcttttgacacaatgcagcaagaacttcagattggagctgatgatgttgaagcatttgttattgacgccgtaagaactaaaatggtctactgcaaaattgatcagacccagagaaaagtagttgtcagtcatagcacacatcggacatttggaaaacagcagtggcaacaactgtatgacacacttaatgcctggaaacaaaatctgaacaaagtgaaaaacagccttttgagtctttctgatacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: