Login to display prices
Login to display prices
KCTD5-potassium channel tetramerisation domain containing 5 Gene View larger

KCTD5-potassium channel tetramerisation domain containing 5 Gene

PTXBC007314

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD5-potassium channel tetramerisation domain containing 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD5-potassium channel tetramerisation domain containing 5 Gene

Proteogenix catalog: PTXBC007314
Ncbi symbol: KCTD5
Product name: KCTD5-potassium channel tetramerisation domain containing 5 Gene
Size: 2ug
Accessions: BC007314
Gene id: 54442
Gene description: potassium channel tetramerisation domain containing 5
Synonyms: BTB/POZ domain-containing protein KCTD5; potassium channel tetramerisation domain containing 5; potassium channel tetramerization domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaatcactgcgagctcctgtcgccggcccggggcggcatcggggcggggctggggggcggcctgtgccgccgctgcagcgctgggctcggcgccctggcccagcgccctggcagcgtgtccaagtgggtccgactcaacgtcggcggcacctacttcctcaccactcggcagaccctgtgccgggacccgaaatccttcctgtaccgcttatgccaggccgatcccgacctggactcagacaaggatgaaacaggcgcctatttaatcgacagagaccccacctactttgggcctgtgctgaactacctgagacacggcaagctggtgattaacaaagacctcgcggaggaaggagtgttggaggaagcagaattttacaatatcacctcattaataaaacttgtaaaggacaaaattagagaacgagacagcaaaacatcgcaggtgcctgtgaagcatgtgtaccgtgtgctgcagtgccaggaggaggagctcacgcagatggtgtccaccatgtccgacggctggaagttcgagcagttggtcagcatcggctcctcttacaactatgggaacgaagaccaagccgagttcctctgtgtggtgtccaaggagctgcacaacaccccgtacggtacggccagcgagcccagcgagaaggccaagattttgcaagaacgaggctcaaggatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: