KCTD5-potassium channel tetramerisation domain containing 5 Gene View larger

KCTD5-potassium channel tetramerisation domain containing 5 Gene

PTXBC007314

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD5-potassium channel tetramerisation domain containing 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD5-potassium channel tetramerisation domain containing 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007314
Product type: DNA & cDNA
Ncbi symbol: KCTD5
Origin species: Human
Product name: KCTD5-potassium channel tetramerisation domain containing 5 Gene
Size: 2ug
Accessions: BC007314
Gene id: 54442
Gene description: potassium channel tetramerisation domain containing 5
Synonyms: BTB/POZ domain-containing protein KCTD5; potassium channel tetramerisation domain containing 5; potassium channel tetramerization domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaatcactgcgagctcctgtcgccggcccggggcggcatcggggcggggctggggggcggcctgtgccgccgctgcagcgctgggctcggcgccctggcccagcgccctggcagcgtgtccaagtgggtccgactcaacgtcggcggcacctacttcctcaccactcggcagaccctgtgccgggacccgaaatccttcctgtaccgcttatgccaggccgatcccgacctggactcagacaaggatgaaacaggcgcctatttaatcgacagagaccccacctactttgggcctgtgctgaactacctgagacacggcaagctggtgattaacaaagacctcgcggaggaaggagtgttggaggaagcagaattttacaatatcacctcattaataaaacttgtaaaggacaaaattagagaacgagacagcaaaacatcgcaggtgcctgtgaagcatgtgtaccgtgtgctgcagtgccaggaggaggagctcacgcagatggtgtccaccatgtccgacggctggaagttcgagcagttggtcagcatcggctcctcttacaactatgggaacgaagaccaagccgagttcctctgtgtggtgtccaaggagctgcacaacaccccgtacggtacggccagcgagcccagcgagaaggccaagattttgcaagaacgaggctcaaggatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - signaling threshold regulating transmembrane adaptor 1
- Ras association (RalGDS/AF-6) domain family member 1
- Ras association (RalGDS/AF-6) domain family member 3
- olfactory receptor, family 10, subfamily W, member 1

Buy KCTD5-potassium channel tetramerisation domain containing 5 Gene now

Add to cart