Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RASSF1-Ras association (RalGDS/AF-6) domain family member 1 Gene
PTXBC110412
New product
Data sheet of RASSF1-Ras association (RalGDS/AF-6) domain family member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RASSF1-Ras association (RalGDS/AF-6) domain family member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC110412 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RASSF1 |
| Origin species: | Human |
| Product name: | RASSF1-Ras association (RalGDS/AF-6) domain family member 1 Gene |
| Size: | 2ug |
| Accessions: | BC110412 |
| Gene id: | 11186 |
| Gene description: | Ras association (RalGDS/AF-6) domain family member 1 |
| Synonyms: | 123F2; NORE2A; RDA32; REH3P21; ras association domain-containing protein 1; Ras association (RalGDS/AF-6) domain family member 1; WUGSC:H_LUCA12.5; cardiac-specific ras association domain family 1 protein; pancreas-specific ras association domain family 1 protein; tumor suppressor protein RDA32; Ras association domain family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcttgaacaaggacggttcttacacaggcttcatcaaggttcagctgaagctggtgcgccctgtctctgtgccctccagcaagaagccaccctccttgcaggatgcccggcggggcccaggacggggcacaagtgtcaggcgccgcacttccttttacctgcccaaggatgctgtcaagcacctgcatgtgctgtcacgcacaagggcacgtgaagtcattgaggccctgctgcgaaagttcttggtggtggatgacccccgcaagtttgcactctttgagcgcgctgagcgtcacggccaagtgtacttgcggaagctgttggatgatgagcagcccctgcggctgcggctcctggcagggcccagtgacaaggccctgagctttgtcctgaaggaaaatgactctggggaggtgaactgggacgccttcagcatgcctgaactacataacttcctacgtatcctgcagcgggaggaggaggagcacctccgccagatcctgcagaagtactcctattgccgccagaagatccaagaggccctgcacgcctgcccccttgggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras association (RalGDS/AF-6) domain family member 3 - olfactory receptor, family 10, subfamily W, member 1 - Ras association (RalGDS/AF-6) domain family member 2 - wingless-type MMTV integration site family, member 11 |