Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNCA-synuclein, alpha (non A4 component of amyloid precursor) Gene
PTXBC013293
New product
Data sheet of SNCA-synuclein, alpha (non A4 component of amyloid precursor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNCA-synuclein, alpha (non A4 component of amyloid precursor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013293 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNCA |
| Origin species: | Human |
| Product name: | SNCA-synuclein, alpha (non A4 component of amyloid precursor) Gene |
| Size: | 2ug |
| Accessions: | BC013293 |
| Gene id: | 6622 |
| Gene description: | synuclein, alpha (non A4 component of amyloid precursor) |
| Synonyms: | NACP; PARK1; PARK4; PD1; alpha-synuclein; non A-beta component of AD amyloid; synuclein alpha-140; synuclein, alpha (non A4 component of amyloid precursor); synuclein alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtattcatgaaaggactttcaaaggccaaggagggagttgtggctgctgctgagaaaaccaaacagggtgtggcagaagcagcaggaaagacaaaagagggtgttctctatgtaggctccaaaaccaaggagggagtggtgcatggtgtggcaacagtggctgagaagaccaaagagcaagtgacaaatgttggaggagcagtggtgacgggtgtgacagcagtagcccagaagacagtggagggagcagggagcattgcagcagccactggctttgtcaaaaaggaccagttgggcaagaatgaagaaggagccccacaggaaggaattctggaagatatgcctgtggatcctgacaatgaggcttatgaaatgccttctgaggaagggtatcaagactacgaacctgaagcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoinositide-3-kinase, regulatory subunit 2 (beta) - six transmembrane epithelial antigen of the prostate 1 - phosphatidylinositol glycan anchor biosynthesis, class F - X-prolyl aminopeptidase (aminopeptidase P) 1, soluble |