Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ERCC8-excision repair cross-complementing rodent repair deficiency, complementation group 8 Gene
PTXBC009793
New product
Data sheet of ERCC8-excision repair cross-complementing rodent repair deficiency, complementation group 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERCC8-excision repair cross-complementing rodent repair deficiency, complementation group 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009793 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERCC8 |
| Origin species: | Human |
| Product name: | ERCC8-excision repair cross-complementing rodent repair deficiency, complementation group 8 Gene |
| Size: | 2ug |
| Accessions: | BC009793 |
| Gene id: | 1161 |
| Gene description: | excision repair cross-complementing rodent repair deficiency, complementation group 8 |
| Synonyms: | CKN1; CSA; UVSS2; DNA excision repair protein ERCC-8; Cockayne syndrome WD-repeat protein CSA; cockayne syndrome WD repeat protein CSA; excision repair cross-complementation group 8; excision repair cross-complementing rodent repair deficiency, complementation group 8; ERCC excision repair 8, CSA ubiquitin ligase complex subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggggtttttgtccgcacgccaaacgggtttggaggaccctcttcgccttcggagagcagagtcaacacggagagttttgggactggaattaaataaagacagagatgttgaaagaatccacggcggtggaattaacacccttgacattgaacctgttgaagggagatacatgttatcaggtggttcagatggtgtgattgtactttatgaccttgagaactccagcagacaatcttattacacatgtaaagcagtgtgttccattggcagagatcatcctgatgttcacagatacagtgtggagactgtacagtggtatcctcatgacactggcatgttcacatcaagctcatttgataaaactctgaaagtatgggatacaaatacattacaaactgcagatgtatttaattttgaggaaacagtttacagtcatcatatgtctccagtctccaccaagcactgtttggtagcagttggtactagaggacccaaagtacaactttgtgacttgaagtctggatcctgttctcacattctacagggtatttttattttatttcaaacggcaactactttgagtaaacgattcaataaaaagaaacgttactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - likely ortholog of mouse lung-inducible Neutralized-related C3HC4 RING domain protein - excision repair cross-complementing rodent repair deficiency, complementation group 6 - excision repair cross-complementing rodent repair deficiency, complementation group 2 - leucine rich repeat and fibronectin type III domain containing 4 |