Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LINCR-likely ortholog of mouse lung-inducible Neutralized-related C3HC4 RING domain protein Gene
PTXBC012317
New product
Data sheet of LINCR-likely ortholog of mouse lung-inducible Neutralized-related C3HC4 RING domain protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LINCR-likely ortholog of mouse lung-inducible Neutralized-related C3HC4 RING domain protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012317 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LINCR |
| Origin species: | Human |
| Product name: | LINCR-likely ortholog of mouse lung-inducible Neutralized-related C3HC4 RING domain protein Gene |
| Size: | 2ug |
| Accessions: | BC012317 |
| Gene id: | 93082 |
| Gene description: | likely ortholog of mouse lung-inducible Neutralized-related C3HC4 RING domain protein |
| Synonyms: | LINCR; E3 ubiquitin-protein ligase NEURL3; lung-inducible neuralized-related C3CH4 RING domain protein; neuralized homolog 3 pseudogene; neuralized-like protein 3; neuralized E3 ubiquitin protein ligase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgaggccaagggcgcacaggtgcgtctggacacgcgtggctgcatcgcgcacaggcgcaccacgttccacgacggcatcgtgttcagccagcggccggtgcgcctgggcgagcgtgtggcgctgcgagtgctgcgggaggagagcggctggtgcggcggcctccgcgtgggcttcacgcgcctggaccccgcgtgcgtgtccgtgcccagcctgccgcccttcctgtgccccgacctggaggagcagagcccgacgtgggcggccgtgctgcctgagggctgcgcgctcactggggacttggtccgcttctgggtggaccgccgcggctgcctcttcgccaaggtcaacgccggctgccggctcctgctgcgtgagggcgtgcccgtcggcgccccgctctgggccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - excision repair cross-complementing rodent repair deficiency, complementation group 6 - excision repair cross-complementing rodent repair deficiency, complementation group 2 - leucine rich repeat and fibronectin type III domain containing 4 - ARP1 actin-related protein 1 homolog B, centractin beta (yeast) |