Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of BNIP1-BCL2/adenovirus E1B 19kDa interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BNIP1-BCL2/adenovirus E1B 19kDa interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010959 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BNIP1 |
| Origin species: | Human |
| Product name: | BNIP1-BCL2/adenovirus E1B 19kDa interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC010959 |
| Gene id: | 662 |
| Gene description: | BCL2/adenovirus E1B 19kDa interacting protein 1 |
| Synonyms: | NIP1; SEC20; TRG-8; vesicle transport protein SEC20; BCL2/adenovirus E1B 19 kDa protein-interacting protein 1; BCL2/adenovirus E1B 19kDa interacting protein 1; transformation-related gene 8 protein; BCL2 interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctccccaagacgtccacgtccggatctgtaaccaagagattgtcaaatttgacctggaggtgaaggcgcttattcaggatatccgtgattgttcaggacccttaagtgctcttactgaactgaatactaaagtaaaagagaaatttcaacagttgcgtcacagaatacaggacctggagcagttggctaaagagcaagacaaagaatcagagaaacaacttctactccaggaagtggagaatcacaaaaagcagatgctcagcaatcaggcctcatggaggaaagctaatctcacctgcaaaattgcaatcgacaatctagagaaagcagaacttcttcagggaggagatctcttaaggcaaaggaaaaccaccaaagagagcctggcccagacatccagtaccatcactgagagcctcatggggatcagcaggatgatggcccagcaggtccagcagagcgaggaggccatgcagtctctagtcacttcttcacgaacgatcctggatgcaaatgaagaatttaagtccatgtcgggcaccatccagctgggccggaagcttatcacaaaatacaatcgccgggagctgacggacaagcttctcatcttccttgcgctagccctgtttcttgctacggtcctctatattgtgaaaaagcggctctttccatttttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - oxidoreductase NAD-binding domain containing 1 - cerebellar degeneration-related protein 2, 62kDa - CDK5 regulatory subunit associated protein 3 - erythrocyte membrane protein band 4.9 (dematin) |