Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMIGD2-transmembrane and immunoglobulin domain containing 2 Gene
PTXBC015655
New product
Data sheet of TMIGD2-transmembrane and immunoglobulin domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMIGD2-transmembrane and immunoglobulin domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015655 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMIGD2 |
| Origin species: | Human |
| Product name: | TMIGD2-transmembrane and immunoglobulin domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC015655 |
| Gene id: | 126259 |
| Gene description: | transmembrane and immunoglobulin domain containing 2 |
| Synonyms: | CD28H; IGPR-1; IGPR1; transmembrane and immunoglobulin domain-containing protein 2; CD28 homolog; CD28 homologue; immunoglobulin and proline-rich receptor 1; immunoglobulin-containing and proline-rich receptor 1; transmembrane and immunoglobulin domain-containing protein 2 variant 2; transmembrane and immunoglobulin domain-containing protein 2 variant 3; transmembrane and immunoglobulin domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtccccgggcatggtgctgggcctcctggtgcagatctgggccctgcaagaagcctcaagcctgagcgtgcagcaggggcccaacttgctgcaggtgaggcagggcagtcaggcgaccctggtctgccaggtggaccaggccacagcctgggaacggctccgtgttaagtggacaaaggatggggccatcctgtgtcaaccgtacatcaccaacggcagcctcagcctgggggtctgcgggccccagggacggctctcctggcaggcacccagccatctcaccctgcagctggaccctgtgagcctcaaccacagcggggcgtacgtgtgctgggcggccgtagagattcctgagttggaggaggctgagggcaacataacaaggctctttgtggacccagatgaccccacacagaacagaaaccggatcgcaagcttcccaggattcctcttcgtgctgctgggggtgggaagcatgggtgtggctgcgatcgtgtggggtgcctggttctggggccgccgcagctgccagcaaagggactcaggtaacagcccaggaaatgcattctacagcaacgtcctataccggccccgggggcccccaaagaagagtgaggactgctctggagaggggaaggaccagaggggccagagcatttattcaacctccttcccgcaaccggccccccgccagccgcacctggcgtcaagaccctgccccagcccgagaccctgccccagccccaggcccggccaccccgtctctatggtcagggtctctcctagaccaagccccacccagcagccgaggccaaaagggttccccaaagtgggagaggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Src homology 2 domain containing transforming protein D - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - eukaryotic translation initiation factor 3, subunit M - potassium channel tetramerisation domain containing 5 |