Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CBY1-chibby homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CBY1-chibby homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016139 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CBY1 |
| Origin species: | Human |
| Product name: | CBY1-chibby homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC016139 |
| Gene id: | 25776 |
| Gene description: | chibby homolog 1 (Drosophila) |
| Synonyms: | C22orf2; CBY; HS508I15A; PGEA1; PIGEA-14; PIGEA14; arb1; protein chibby homolog 1; ARPP-binding protein; PKD2 interactor, Golgi and endoplasmic reticulum-associated 1; chibby CTNNB1-mediated transcription inhibitor; chibby homolog 1; coiled-coil protein PIGEA-14; cytosolic leucine-rich protein; polycystin-2 interactor, Golgi- and endoplasmic reticulum-associated protein, 14 kDa; chibby family member 1, beta catenin antagonist |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctttctttgggaatacgttcagtccgaagaagacacctcctcggaagtcggcatctctctccaacctgcattctttggatcgatcaacccgggaggtggagctgggcttggaatacggatccccgactatgaacctggcagggcaaagcctgaagtttgaaaatggccagtggatagcagagacaggggttagtggcggtgtggaccggagggaggttcagcgccttcgcaggcggaaccagcagttggaggaagagaacaatctcttgcggctgaaagtggacatcttattagacatgctttcagagtccactgctgaatcccacttaatggagaaggaactggatgaactgaggatcagccggaagagaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome maturation protein - epithelial membrane protein 3 - ribosomal protein, large, P2 - four and a half LIM domains 2 |