EMP3-epithelial membrane protein 3 Gene

View larger

EMP3-epithelial membrane protein 3 Gene

Reference: PTXBC009718

Condition: New product

Print

Data sheet of EMP3-epithelial membrane protein 3 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about EMP3-epithelial membrane protein 3 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC009718
Product type:	DNA & cDNA
Ncbi symbol:	EMP3
Origin species:	Human
Product name:	EMP3-epithelial membrane protein 3 Gene
Size:	2ug
Accessions:	BC009718
Gene id:	2014
Gene description:	epithelial membrane protein 3
Synonyms:	YMP; epithelial membrane protein 3; EMP-3; HNMP-1; hematopoietic neural membrane protein 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtcactcctcttgctggtggtctcagcccttcacatcctcattcttatactgcttttcgtggccactttggacaagtcctggtggactctccctgggaaagagtccctgaatctctggtacgactgcacgtggaacaacgacaccaaaacatgggcctgcagtaatgtcagcgagaatggctggctgaaggcggtgcaggtcctcatggtgctctccctcattctctgctgtctctccttcatcctgttcatgttccagctctacaccatgcgacgaggaggtctcttctatgccaccggcctctgccagctttgcaccagcgtggcggtgtttactggcgccttgatctatgccatccacgccgaggagatcctggagaagcacccgcgagggggcagcttcggatactgcttcgccctggcctgggtggccttccccctcgccctggtcagcggcatcatctacatccacctacggaagcgggagtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- ribosomal protein, large, P2 - four and a half LIM domains 2 - polycomb group ring finger 6 - mab-21-like 2 (C. elegans)

Reviews

Be the first to write your review !

Buy EMP3-epithelial membrane protein 3 Gene now