Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RPLP2-ribosomal protein, large, P2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPLP2-ribosomal protein, large, P2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005354 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPLP2 |
| Origin species: | Human |
| Product name: | RPLP2-ribosomal protein, large, P2 Gene |
| Size: | 2ug |
| Accessions: | BC005354 |
| Gene id: | 6181 |
| Gene description: | ribosomal protein, large, P2 |
| Synonyms: | D11S2243E; LP2; RPP2; 60S acidic ribosomal protein P2; acidic ribosomal phosphoprotein P2; renal carcinoma antigen NY-REN-44; ribosomal protein, large, P2; ribosomal protein lateral stalk subunit P2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgctacgtcgcctcctacctgctggctgccctagggggcaactcctcccccagcgccaaggacatcaagaagatcttggacagcgtgggtatcgaggcggacgacgaccggctcaacaaggttatcagtgagctgaatggaaaaaacattgaagacgtcattgcccagggtattggcaagcttgccagtgtacctgctggtggggctgtagccgtctctgctgccccaggctctgcagcccctgctgctggttctgcccctgctgcagcagaggagaagaaagatgagaagaaggaggagtctgaagagtcagatgatgacatgggatttggcctttttgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - four and a half LIM domains 2 - polycomb group ring finger 6 - mab-21-like 2 (C. elegans) - RING1 and YY1 binding protein |