Login to display prices
Login to display prices
RYBP-RING1 and YY1 binding protein Gene View larger

RYBP-RING1 and YY1 binding protein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RYBP-RING1 and YY1 binding protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RYBP-RING1 and YY1 binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036459
Product type: DNA & cDNA
Ncbi symbol: RYBP
Origin species: Human
Product name: RYBP-RING1 and YY1 binding protein Gene
Size: 2ug
Accessions: BC036459
Gene id: 23429
Gene description: RING1 and YY1 binding protein
Synonyms: ring1 interactor RYBP; AAP1; APAP-1; DEDAF; YEAF1; RING1 and YY1-binding protein; DED-associated factor; YY1 and E4TF1 associated factor 1; apoptin-associating protein 1; death effector domain-associated factor; RING1 and YY1 binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccatgggcgacaagaagagcccgaccaggccaaaaagacaagcgaaacctgccacagacgaagggttttgggattgtagcgtctgcaccttcagaaacagtgctgaagcctttaaatgcagcatctgcgatgtgaggaaaggcacctccaccagaaaacctcggatcaattctcagctggtggcacaacaagtggcacaacagtatgccaccccaccaccccctaaaaaggagaagaaggagaaagttgaaaagcaggacaaagagaaacctgagaaagacaaggaaattagtcctagtgttaccaagaaaaataccaacaagaaaaccaaaccaaagtctgacattctgaaagatcctcctagtgaagcaaacagcatacagtctgcaaatgctacaacaaagaccagcgaaacaaatcacacctcaaggccccggctgaaaaacgtggacaggagcactgcacagcagttggcagtaactgtgggcaacgtcaccgtcattatcacagactttaaggaaaagactcgctcctcatcgacatcctcatccacagtgacctccagtgcagggtcagaacagcagaaccagagcagctcggggtcagagagcacagacaagggctcctcccgttcctccacgccaaagggcgacatgtcagcagtcaatgatgaatctttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cartilage associated protein
- replication protein A1, 70kDa
- integrator complex subunit 7
- canopy 1 homolog (zebrafish)