Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of POMP-proteasome maturation protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POMP-proteasome maturation protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003390 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POMP |
| Origin species: | Human |
| Product name: | POMP-proteasome maturation protein Gene |
| Size: | 2ug |
| Accessions: | BC003390 |
| Gene id: | 51371 |
| Gene description: | proteasome maturation protein |
| Synonyms: | C13orf12; HSPC014; PNAS-110; UMP1; proteasome maturation protein; 2510048O06Rik; hUMP1; protein UMP1 homolog; voltage-gated K channel beta subunit 4.1; voltage-gated potassium channel beta subunit 4.1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgccagaggacttggatctgagctaaaggacagtattccagttactgaactttcagcaagtggaccttttgaaagtcatgatcttcttcggaaaggtttttcttgtgtgaaaaatgaacttttgcctagtcatccccttgaattatcagaaaaaaatttccagctcaaccaagataaaatgaatttttccacactgagaaacattcagggtctatttgctccgctaaaattacagatggaattcaaggcagtgcagcaggttcagcgtcttccatttctttcaagctcaaatctttcactggatgttttgaggggtaatgatgagactattggatttgaggatattcttaatgatccatcacaaagcgaagtcatgggagagccacacttgatggtggaatataaacttggtttactgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - epithelial membrane protein 3 - ribosomal protein, large, P2 - four and a half LIM domains 2 - polycomb group ring finger 6 |