Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SYS1-SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) Gene
PTXBC048286
New product
Data sheet of SYS1-SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SYS1-SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC048286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SYS1 |
| Origin species: | Human |
| Product name: | SYS1-SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC048286 |
| Gene id: | 90196 |
| Gene description: | SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) |
| Synonyms: | SYS1, golgi trafficking protein; Sys1 golgi trafficking protein; SYS1 Golgi-localized integral membrane protein homolog; protein SYS1 homolog; C20orf169; dJ453C12.4; dJ453C12.4.1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggtcagttccgcagctacgtgtgggacccgctgctgatcctgtcgcagatcgtcctcatgcagaccgtgtattacggctcgctgggcctgtggctggcgctggtggacgggctagtgcgaagcagcccctcgctggaccagatgttcgacgccgagatcctgggcttttccacccctccaggccggctctccatgatgtccttcatcctcaacgccctcacctgtgccctgggcttgctgtacttcatccggcgaggaaagcagtgtctggatttcactgtcactgtccatttctttcacctcctgggctgctggttctacagctcccgtttcccctcggcgctgacctggtggctggtccaagccgtgtgcattgcactcatggctgtcatcggggagtacctgtgcatgcggacggagctcaaggagatacccctcaactcagcccctaaatccaatgtctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide - pleckstrin homology domain containing, family B (evectins) member 2 - translocase of outer mitochondrial membrane 40 homolog (yeast)-like - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 |