No products
Prices are tax excluded
PTXBC048286
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC048286 |
Product type: | DNA & cDNA |
Ncbi symbol: | SYS1 |
Origin species: | Human |
Product name: | SYS1-SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC048286 |
Gene id: | 90196 |
Gene description: | SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) |
Synonyms: | SYS1, golgi trafficking protein; Sys1 golgi trafficking protein; SYS1 Golgi-localized integral membrane protein homolog; protein SYS1 homolog; C20orf169; dJ453C12.4; dJ453C12.4.1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcgggtcagttccgcagctacgtgtgggacccgctgctgatcctgtcgcagatcgtcctcatgcagaccgtgtattacggctcgctgggcctgtggctggcgctggtggacgggctagtgcgaagcagcccctcgctggaccagatgttcgacgccgagatcctgggcttttccacccctccaggccggctctccatgatgtccttcatcctcaacgccctcacctgtgccctgggcttgctgtacttcatccggcgaggaaagcagtgtctggatttcactgtcactgtccatttctttcacctcctgggctgctggttctacagctcccgtttcccctcggcgctgacctggtggctggtccaagccgtgtgcattgcactcatggctgtcatcggggagtacctgtgcatgcggacggagctcaaggagatacccctcaactcagcccctaaatccaatgtctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide - pleckstrin homology domain containing, family B (evectins) member 2 - translocase of outer mitochondrial membrane 40 homolog (yeast)-like - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 |