Login to display prices
Login to display prices
SULT1A3-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 Gene View larger

SULT1A3-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 Gene

PTXBC014471

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SULT1A3-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SULT1A3-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 Gene

Proteogenix catalog: PTXBC014471
Ncbi symbol: SULT1A3
Product name: SULT1A3-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 Gene
Size: 2ug
Accessions: BC014471
Gene id: 6818
Gene description: sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3
Synonyms: HAST; HAST3; M-PST; ST1A3; ST1A3/ST1A4; ST1A5; STM; TL-PST; sulfotransferase 1A3; aryl sulfotransferase 1A3/1A4; catecholamine-sulfating phenol sulfotransferase; dopamine-specific sulfotransferase; monoamine-sulfating phenosulfotransferase; phenol sulfotransferase 1A5; placental estrogen sulfotransferase; sulfokinase; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3; thermolabile (monoamine, M form) phenol sulfotransferase; sulfotransferase family 1A member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgatccaggacacctcccgcccgccactggagtacgtgaagggggtcccgctcatcaagtactttgcagaggcactggggcccctgcagagcttccaagcccgacctgatgacctgctcatcaacacctaccccaagtctggcaccacctgggtgagccagatactggacatgatctaccagggcggcgacctagagaagtgtaaccgggctcccatctacgtacgggtgcccttccttgaggttaatgatccaggggaaccctcagggctggagactctgaaagacacaccgcccccacggctcatcaagtcacacctgcccctggctctgctccctcagactctgttggatcagaaggtcaaggtggtctatgttgcccgaaacccaaaggacgtggcggtctcctactaccatttccaccgtatggaaaaggcgcaccctgagcctgggacctgggacagcttcctggaaaagttcatggctggagaagtgtcctacgggtcctggtaccagcacgtgcaggagtggtgggagctgagccgcacccaccctgttctctacctcttctatgaagacatgaaggagaaccccaaaagggagattcaaaagatcctggagtttgtggggcgctccctgccagaggagaccatggacttcatggttcagcacacgtcgttcaaggagatgaagaagaaccctatgaccaactacaccaccgtcccccaggagctcatggaccacagcatctcccccttcatgaggaaaggcatggctggggactggaagaccaccttcaccgtggcgcagaatgagcgcttcgatgcggactatgcggagaagatggcaggctgcagcctcagcttccgctctgagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: