Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TOMM40L-translocase of outer mitochondrial membrane 40 homolog (yeast)-like Gene
PTXBC014946
New product
Data sheet of TOMM40L-translocase of outer mitochondrial membrane 40 homolog (yeast)-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TOMM40L-translocase of outer mitochondrial membrane 40 homolog (yeast)-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014946 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOMM40L |
| Origin species: | Human |
| Product name: | TOMM40L-translocase of outer mitochondrial membrane 40 homolog (yeast)-like Gene |
| Size: | 2ug |
| Accessions: | BC014946 |
| Gene id: | 84134 |
| Gene description: | translocase of outer mitochondrial membrane 40 homolog (yeast)-like |
| Synonyms: | TOMM40B; mitochondrial import receptor subunit TOM40B; protein TOMM40-like; translocase of outer mitochondrial membrane 40 homolog-like; translocase of outer mitochondrial membrane 40 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaacacattgggcctggcaccaatggggactttgccccgccggagcccccgccgagaggaacccctgcccaaccctgggagcttcgatgagctgcaccgtctatgcaaagatgtattcccagcacagatggagggagtgaagctcgttgtcaacaaggttctgagcagccatttccaggtggcgcacactatacacatgagtgccctgggcttgccgggatatcacctccatgcggcctatgcaggggattggcagctcagtcccactgaggtgttccccactgtggtaggggatatggacagcagtggcagcctgaacgcccaggtcttgctcctcttggcagagcggctccgagctaaggctgtcttccagacgcagcaggccaagttcctgacatggcagtttgatggcgagtatcggggagatgactacacagccactctgaccctaggaaatcctgacctgattggggagtcggtgatcatggttgctcacttcctgcagagcctcactcatcggctggtgctgggaggagagctagtttatcaccggcggccaggcgaagagggggccatcttgacactggctgggaagtactcggctgtacactgggtagctacattgaatgtgggatcaggcggggcccatgcaagttactaccacagggcaaatgaacaggttcaggttggagtggagtttgaggcaaacacaaggctacaagacacaacattctcctttggttaccacctgactctgccccaggccaacatggtatttagaggcttggtggatagtaactggtgtgtaggtgctgtgctggagaagaagatgccccctctgcctgtcaccctagcccttggagccttcctcaatcactggcgcaacagattccattgtggcttcagcatcactgtgggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 - solute carrier family 25 (mitochondrial carrier, brain), member 14 - zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2 |