Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCER1G-Fc fragment of IgE, high affinity I, receptor for, gamma polypeptide Gene
PTXBC033872
New product
Data sheet of FCER1G-Fc fragment of IgE, high affinity I, receptor for, gamma polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCER1G-Fc fragment of IgE, high affinity I, receptor for, gamma polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033872 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCER1G |
| Origin species: | Human |
| Product name: | FCER1G-Fc fragment of IgE, high affinity I, receptor for, gamma polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC033872 |
| Gene id: | 2207 |
| Gene description: | Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide |
| Synonyms: | FCRG; high affinity immunoglobulin epsilon receptor subunit gamma; Fc epsilon receptor Ig; Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide; Fc receptor gamma-chain; fc-epsilon RI-gamma; fcRgamma; fceRI gamma; immunoglobulin E receptor, high affinity, gamma chain; Fc fragment of IgE receptor Ig |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattccagcagtggtcttgctcttactccttttggttgaacaagcagcggccctgggagagcctcagctctgctatatcctggatgccatcctgtttctgtatggaattgtcctcaccctcctctactgtcgactgaaggtaatccaagtgcgaaaggcagctataaccagctatgagaaatcagatggtgtttacacgggcctgagcaccaggaaccaggagacttacgagactctgaagcatgagaaaccaccacagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family B (evectins) member 2 - translocase of outer mitochondrial membrane 40 homolog (yeast)-like - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 |