Login to display prices
Login to display prices
RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene View larger

RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene

PTXBC020780

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020780
Product type: DNA & cDNA
Ncbi symbol: RBPJ
Origin species: Human
Product name: RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene
Size: 2ug
Accessions: BC020780
Gene id: 3516
Gene description: recombination signal binding protein for immunoglobulin kappa J region
Synonyms: AOS3; CBF1; IGKJRB; IGKJRB1; KBF2; RBP-J; RBPJK; RBPSUH; SUH; csl; recombining binding protein suppressor of hairless; CBF-1; H-2K binding factor-2; RBP-J kappa; RBP-JK; immunoglobulin kappa J region recombination signal binding protein 1; renal carcinoma antigen NY-REN-30; suppressor of hairless homolog; recombination signal binding protein for immunoglobulin kappa J region
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggggctgcaggaaatttggtgagcggcctccacctaaacgacttactagggaagctatgcgaaattatttaaaagagcgaggggatcaaacagtacttattcttcatgcaaaagttgcacagaagtcatatggaaatgaaaaaaggtttttttgcccacctccttgtgtatatcttatgggcagcggatggaagaaaaaaaaagaacaaatggaacgcgatggttgttctgaacaagagtctcaaccgtgtgcatttattgggataggaaatagtgaccaagaaatgcagcagctaaacttggaaggaaagaactattgcacagccaaaacattgtatatatctgactcagacaagcgaaagcacttcatgttgtctgtaaagatgttctatggcaacagtgatgacattggtgtgttcctcagcaagcggataaaagtcatctccaaaccttccaaaaagaagcagtcattgaaaaatgctgacttatgcattgcctcaggaacaaaggtggctctgtttaatcgactacgatcccagacagttagtaccagatacttgcatgtagaaggaggtaattttcatgccagttcacagcagtggggagccttttttattcatctcttggatgatgatgaatcagaaggagaagaattcacagtccgagatggctacatccattatggacaaacagtcaaacttgtgtgctcagttactggcatggcactcccaagattgataattaggaaagttgataagcagaccgcattattggatgcagatgatcctgtgtcacaactccataaatgtgcattttaccttaaggatacagaaagaatgtatttgtgcctttctcaagaaagaataattcaatttcaggccactccatgtccaaaagaaccaaataaagagatgataaatgatggcgcttcctggacaatcattagcacagataaggcagagtatacattttatgagggaatgggccctgtccttgccccagtcactcctgtgcctgtggtagagagccttcagttgaatggcggtggggacgtagcaatgcttgaacttacaggacagaatttcactccaaatttacgagtgtggtttggggatgtagaagctgaaactatgtacaggtgtggagagagtatgctctgtgtcgtcccagacatttctgcattccgagaaggttggagatgggtccggcaaccagtccaggttccagtaactttggtccgaaatgatggaatcatttattccaccagccttacctttacctacacaccagaaccagggccgcggccacattgcagtgcagcaggagcaatccttcgagccaattcaagccaggtgccccctaacgaatcaaacacaaacagcgagggaagttacacaaacgccagcacaaattcaaccagtgtcacatcatctacagccacagtggtatcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
- Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
- pleckstrin homology domain containing, family B (evectins) member 2
- translocase of outer mitochondrial membrane 40 homolog (yeast)-like