Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene
PTXBC020780
New product
Data sheet of RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020780 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBPJ |
| Origin species: | Human |
| Product name: | RBPJ-recombination signal binding protein for immunoglobulin kappa J region Gene |
| Size: | 2ug |
| Accessions: | BC020780 |
| Gene id: | 3516 |
| Gene description: | recombination signal binding protein for immunoglobulin kappa J region |
| Synonyms: | AOS3; CBF1; IGKJRB; IGKJRB1; KBF2; RBP-J; RBPJK; RBPSUH; SUH; csl; recombining binding protein suppressor of hairless; CBF-1; H-2K binding factor-2; RBP-J kappa; RBP-JK; immunoglobulin kappa J region recombination signal binding protein 1; renal carcinoma antigen NY-REN-30; suppressor of hairless homolog; recombination signal binding protein for immunoglobulin kappa J region |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggctgcaggaaatttggtgagcggcctccacctaaacgacttactagggaagctatgcgaaattatttaaaagagcgaggggatcaaacagtacttattcttcatgcaaaagttgcacagaagtcatatggaaatgaaaaaaggtttttttgcccacctccttgtgtatatcttatgggcagcggatggaagaaaaaaaaagaacaaatggaacgcgatggttgttctgaacaagagtctcaaccgtgtgcatttattgggataggaaatagtgaccaagaaatgcagcagctaaacttggaaggaaagaactattgcacagccaaaacattgtatatatctgactcagacaagcgaaagcacttcatgttgtctgtaaagatgttctatggcaacagtgatgacattggtgtgttcctcagcaagcggataaaagtcatctccaaaccttccaaaaagaagcagtcattgaaaaatgctgacttatgcattgcctcaggaacaaaggtggctctgtttaatcgactacgatcccagacagttagtaccagatacttgcatgtagaaggaggtaattttcatgccagttcacagcagtggggagccttttttattcatctcttggatgatgatgaatcagaaggagaagaattcacagtccgagatggctacatccattatggacaaacagtcaaacttgtgtgctcagttactggcatggcactcccaagattgataattaggaaagttgataagcagaccgcattattggatgcagatgatcctgtgtcacaactccataaatgtgcattttaccttaaggatacagaaagaatgtatttgtgcctttctcaagaaagaataattcaatttcaggccactccatgtccaaaagaaccaaataaagagatgataaatgatggcgcttcctggacaatcattagcacagataaggcagagtatacattttatgagggaatgggccctgtccttgccccagtcactcctgtgcctgtggtagagagccttcagttgaatggcggtggggacgtagcaatgcttgaacttacaggacagaatttcactccaaatttacgagtgtggtttggggatgtagaagctgaaactatgtacaggtgtggagagagtatgctctgtgtcgtcccagacatttctgcattccgagaaggttggagatgggtccggcaaccagtccaggttccagtaactttggtccgaaatgatggaatcatttattccaccagccttacctttacctacacaccagaaccagggccgcggccacattgcagtgcagcaggagcaatccttcgagccaattcaagccaggtgccccctaacgaatcaaacacaaacagcgagggaagttacacaaacgccagcacaaattcaaccagtgtcacatcatctacagccacagtggtatcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) - Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide - pleckstrin homology domain containing, family B (evectins) member 2 - translocase of outer mitochondrial membrane 40 homolog (yeast)-like |