ZNF254-zinc finger protein 254 Gene View larger

ZNF254-zinc finger protein 254 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF254-zinc finger protein 254 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF254-zinc finger protein 254 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC056243
Product type: DNA & cDNA
Ncbi symbol: ZNF254
Origin species: Human
Product name: ZNF254-zinc finger protein 254 Gene
Size: 2ug
Accessions: BC056243
Gene id: 9534
Gene description: zinc finger protein 254
Synonyms: BMZF-5; HD-ZNF1; ZNF539; ZNF91L; zinc finger protein 254; CTD-2017D11.1; bone marrow zinc finger 5; hematopoietic cell-derived zinc finger protein 1; zinc finger protein 539
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaggaccccctagaagcctagaaatgggactgttgacatttagggatgtggccatagaattctctctggaggagtggcaacacctggacattgcacagcagaatttatatagaaatgtgatgttagagaactacagaaacctggccttcctgggtattgctgtctctaagccagacctgatcacctgtctggaacaagggaaagagccctggaatatgaagcgacatgagatggtggatgaacccccaggattggatttttcattactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - short coiled-coil protein
- zinc finger protein 169
- zinc finger protein 449
- zinc finger protein 317

Buy ZNF254-zinc finger protein 254 Gene now

Add to cart