ZNF449-zinc finger protein 449 Gene View larger

ZNF449-zinc finger protein 449 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF449-zinc finger protein 449 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF449-zinc finger protein 449 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC065938
Product type: DNA & cDNA
Ncbi symbol: ZNF449
Origin species: Human
Product name: ZNF449-zinc finger protein 449 Gene
Size: 2ug
Accessions: BC065938
Gene id: 203523
Gene description: zinc finger protein 449
Synonyms: ZSCAN19; zinc finger protein 449; zinc finger and SCAN domain-containing protein 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtggccctgggttgtgcaatccaggcatccttgaatcaaggctctgtgtttcaagaatatgatactgactgtgaagttttccgtcagcgcttcaggcagttccagtacagagaagcagctgggcctcatgaagcatttaacaaactctgggagctttgctgtcaatggctgaagccaaagatgcgctctaaggaacaaatcctggagctgctagtgttggagcaattcctaactatcctgcccacagagatagagacctgggtgagggagcactgcccagagaatagagaaagagttgtgtcactgatagaagacttacagagagaacttgagataccagagcagcagacatttgctgctgaatacagtcactactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 317
- zinc finger protein 770
- lipase, hormone-sensitive
- bolA homolog 2 (E. coli)

Buy ZNF449-zinc finger protein 449 Gene now

Add to cart