Login to display prices
Login to display prices
SCOC-short coiled-coil protein Gene View larger

SCOC-short coiled-coil protein Gene

PTXBC062684

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCOC-short coiled-coil protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCOC-short coiled-coil protein Gene

Proteogenix catalog: PTXBC062684
Ncbi symbol: SCOC
Product name: SCOC-short coiled-coil protein Gene
Size: 2ug
Accessions: BC062684
Gene id: 60592
Gene description: short coiled-coil protein
Synonyms: HRIHFB2072; SCOCO; UNC-69; short coiled-coil protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgggtccaggaaagaggaggaggaagacagcacattcaccaacatttctcttgcagatgacatagaccattcctcaagaattttgtatccaaggcccaaaagtttgttacccaagatgatgaatgctgacatggatgttgatgctgaaaatcaagtggaactggaggaaaaaacaagacttattaatcaagtgttggaactccaacacacacttgaagatctctctgcaagagtagatgcagttaaggaagaaaatctgaagctaaaatcagaaaaccaagttcttggacaatatatagaaaatctcatgtcagcttctagtgtttttcaaacaactgacacaaaaagcaaaagaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: