ZNF169-zinc finger protein 169 Gene View larger

ZNF169-zinc finger protein 169 Gene

PTXBC019228

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF169-zinc finger protein 169 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF169-zinc finger protein 169 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019228
Product type: DNA & cDNA
Ncbi symbol: ZNF169
Origin species: Human
Product name: ZNF169-zinc finger protein 169 Gene
Size: 2ug
Accessions: BC019228
Gene id: 169841
Gene description: zinc finger protein 169
Synonyms: zinc finger protein 169
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaccaggactcctgacaaccaggaaggaggcattgatggccttccgggatgtggctgtggccttcacccagaaggagtggaagctattgagttctgctcagaggaccctgtacagggaggtgatgctggagaactacagccatctggtctccctgggaattgcattttccaaaccaaaactcatcgaacagctggagcaaggcgacgaaccttggagagaggagaacgaacatcttctggacctttgtccaggcaggcggatcacaaggtcgggagttcgagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 449
- zinc finger protein 317
- zinc finger protein 770
- lipase, hormone-sensitive

Buy ZNF169-zinc finger protein 169 Gene now

Add to cart