Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ATM-ataxia telangiectasia mutated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATM-ataxia telangiectasia mutated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022307 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATM |
| Origin species: | Human |
| Product name: | ATM-ataxia telangiectasia mutated Gene |
| Size: | 2ug |
| Accessions: | BC022307 |
| Gene id: | 472 |
| Gene description: | ataxia telangiectasia mutated |
| Synonyms: | ATM serine/threonine kinase; serine-protein kinase ATM; AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1; A-T mutated; AT mutated; TEL1, telomere maintenance 1, homolog; ataxia telangiectasia mutated |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgttacatgagccagcaaattctagtgccagtcagagcactgacctctgtgacttttcaggggatttggatcctgctcctaatccacctcattttccatcgcatgtgattaaagcaacatttgcctatatcagcaattgtcataaaaccaagttaaaaagcattttagaaattctttccaaaagccctgattcctatcagaaaattcttcttgccatatgtgagcaagcagctgaaacaaataatgtttataagaagcacagaattcttaaaatatatcacctgtttgttagtttattactgaaagatataaaaagtggcttaggaggagcttgggcctttgttcttcgagacgttatttatactttgattcactatatcaaccaaaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PWP1 homolog (S. cerevisiae) - mediator complex subunit 20 - HEAT repeat containing 5A - dihydropyrimidinase-like 3 |