MED20-mediator complex subunit 20 Gene View larger

MED20-mediator complex subunit 20 Gene

PTXBC012618

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MED20-mediator complex subunit 20 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MED20-mediator complex subunit 20 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012618
Product type: DNA & cDNA
Ncbi symbol: MED20
Origin species: Human
Product name: MED20-mediator complex subunit 20 Gene
Size: 2ug
Accessions: BC012618
Gene id: 9477
Gene description: mediator complex subunit 20
Synonyms: PRO0213; TRFP; mediator of RNA polymerase II transcription subunit 20; Trf (TATA binding protein-related factor)-proximal homolog; mediator complex subunit 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagtgacttgtgtgtcccagatgcctgtggccgagggcaagagtgttcagcaaaccgtagagctccttacccggaaattggagatgcttggggcagagaagcaaggaacattttgtgtggactgtgagacttaccatacggccgcctctacccttggcagccaaggtcagaccgggaagctgatgtatgtgatgcacaactcagagtacccattgagctgtttcgccctctttgagaatggcccttgccttattgctgacaccaactttgatgtgcttatggtgaagctcaagggctttttccagagtgctaaggccagcaagattgagacccggggcaccaggtaccagtactgtgacttcctggtgaaggtgggcacggtcacaatggggcccagtgcccggggcatctctgtggaggtggagtatggcccctgtgtggtagctagtgactgctggagtctgctgctcgagttcctacagagttttctaggcagccacacaccaggggctcccgcagtgtttgggaacagacatgatgcggtctacggcccagcagataccatggtccagtacatggaactcttcaacaagatccgcaagcagcagcaggtgccggtggctgggattcgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HEAT repeat containing 5A
- dihydropyrimidinase-like 3
- chemokine (C motif) ligand 1
- glucuronidase, beta-like 1

Buy MED20-mediator complex subunit 20 Gene now

Add to cart