HEATR5A-HEAT repeat containing 5A Gene View larger

HEATR5A-HEAT repeat containing 5A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEATR5A-HEAT repeat containing 5A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HEATR5A-HEAT repeat containing 5A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062720
Product type: DNA & cDNA
Ncbi symbol: HEATR5A
Origin species: Human
Product name: HEATR5A-HEAT repeat containing 5A Gene
Size: 2ug
Accessions: BC062720
Gene id: 25938
Gene description: HEAT repeat containing 5A
Synonyms: C14orf125; HEAT repeat-containing protein 5A; HEAT repeat containing 5A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaattagctcatagcttactgctgaatgaagaagcatacaatcaactaggtgaagttcagaaggcagagtttatttttgagtggttgagatacttggagaagctcttgttggcaaccagcaggaatgatgtaagggagaaacagaagactcttgttgaacagctcctgtctttgttgaacagctccccagggcctcctacccgcaaactgcttgctaagaatctagccatactttatagtattggagacacattctccgttcatgaagcaatcgataaatgtaatgatcttattcgtagcaaagatgattctccaagttatcttcccactaagctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dihydropyrimidinase-like 3
- chemokine (C motif) ligand 1
- glucuronidase, beta-like 1
- transmembrane protein 207

Buy HEATR5A-HEAT repeat containing 5A Gene now

Add to cart