Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PWP1-PWP1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PWP1-PWP1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010921 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PWP1 |
| Origin species: | Human |
| Product name: | PWP1-PWP1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC010921 |
| Gene id: | 11137 |
| Gene description: | PWP1 homolog (S. cerevisiae) |
| Synonyms: | PWP1 homolog, endonuclein; nuclear phosphoprotein similar to S. cerevisiae PWP1; IEF-SSP-9502; periodic tryptophan protein 1 homolog; endonuclein; keratinocyte protein IEF SSP 9502 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccgcagccgccaggtgacgtgcgtggcctgggtccgctgcggcgtggccaaagagacaccagacaaggtagagctgagtaaagaagaagtaaaacgcctcattgctgaggcaaaggagaaattgcaagaagaaggtggtggcagtgatgaagaggagacaggcagtccttcagaagatggcatgcagagtgcacgcacccaggcacgcccaagagagcccctggaggatggtgacccagaggatgacaggacgcttgatgatgatgagctggctgagtacgacttagataaatatgatgaggaaggtgacccagatgctgagactcttggtgaatctctcttgggtcttacggtctacgggagtaatgatcaagatccttacgttactctgaaagatacatcaatgacatttttttcctctcacttaggaacaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mediator complex subunit 20 - HEAT repeat containing 5A - dihydropyrimidinase-like 3 - chemokine (C motif) ligand 1 |