Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RIPK3-receptor-interacting serine-threonine kinase 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIPK3-receptor-interacting serine-threonine kinase 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIPK3 |
| Origin species: | Human |
| Product name: | RIPK3-receptor-interacting serine-threonine kinase 3 Gene |
| Size: | 2ug |
| Accessions: | BC041668 |
| Gene id: | 11035 |
| Gene description: | receptor-interacting serine-threonine kinase 3 |
| Synonyms: | receptor-interacting serine/threonine-protein kinase 3; RIP-3; RIP-like protein kinase 3; receptor interacting protein 3; receptor interacting serine/threonine kinase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtgcgtcaagttatggcccagcggtgcccccgcccccttggtgtccatcgaggaactggagaaccaggagctcgtcggcaaaggcgggttcggcacagtgttccgggcgcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgaaggcgatatccagggaggtcaaggccatggcaagtctggataacgaattcgtgctgcgcctagaaggggttatcgagaaggtgaactgggaccaagatcccaagccggctctggtgactaaattcatggagaacggctccttgtcggggctgctgcagtcccagtgccctcggccctggccgctcctttgccgcctgctgaaagaagtggtgcttgggatgttttacctgcaccgggacctcaagccatccaacgtcctgctggacccagagctgcacgtcaaggtcagctggtctacacccctctcagcctcaagacaaggccccagagctgctccagccaggcccgccggacactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NIMA (never in mitosis gene a)-related kinase 2 - HERV-FRD provirus ancestral Env polyprotein - mannose-6-phosphate receptor (cation dependent) - spectrin repeat containing, nuclear envelope 2 |