Login to display prices
Login to display prices
HERV-FRD-HERV-FRD provirus ancestral Env polyprotein Gene View larger

HERV-FRD-HERV-FRD provirus ancestral Env polyprotein Gene

PTXBC068585

New product

Data sheet of HERV-FRD-HERV-FRD provirus ancestral Env polyprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HERV-FRD-HERV-FRD provirus ancestral Env polyprotein Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC068585
Ncbi symbol: HERV-FRD
Product name: HERV-FRD-HERV-FRD provirus ancestral Env polyprotein Gene
Size: 2ug
Accessions: BC068585
Gene id: 405754
Gene description: HERV-FRD provirus ancestral Env polyprotein
Synonyms: HERV-FRD provirus ancestral Env polyprotein; HERV-FRD; ERVFRDE1; GLLL6191; HERV-W/FRD; UNQ6191; envFRD; syncytin-2; HERV-FRD_6p24.1 provirus ancestral Env polyprotein; envelope polyprotein; syncytin 2; endogenous retrovirus group FRD member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctgctcctgctggttctcattctcacgccttcactagcagcctaccgccatcctgatttcccgttattggaaaaagctcagcaactgctccaaagtacaggatccccttactccaccaattgctggttatgtactagctcttccactgaaacaccagggacagcttatccagcctcgcccagagaatggacaagcatagaggcggaattacatatttcctatcgatgggaccctaatctgaaaggactgatgaggcctgcaaatagtcttctttcaacagtaaagcaagatttccctgatatccgccagaaacctcccattttcggacccatctttactaatatcaacctaatgggaatagcccctatttgtgttatggccaaaaggaaaaatggaacaaatgtaggcactcttccaagtacagtctgtaatgttactttcactgtagattctaaccaacagacttaccaaacatacacccacaaccaattccgccatcaaccaagattccccaaacctccaaatattacttttcctcagggaactttgctagataaatccagccggttttgccagggacgcccaagctcatgcagtactcgaaacttctggttccggcctgctgattataaccaatgtctgcaaatttccaacctcagctctacagcggaatgggttctattggaccaaactcgaaattctcttttttgggaaaataaaaccaagggagctaaccagagccaaacaccctgcgtccaagtcttagcaggcatgactatagccaccagctacctgggcatatcagcagtctcagaattttttggaacctccctcacccccttatttcatttccatatctctacatgccttaaaactcaaggagccttttatatttgtggccagtcgattcaccaatgcctccccagtaactggactggaacttgtaccataggctatgtaaccccagacatcttcatagcccctggcaatctctctcttccaataccaatctatgggaattccccgttgcccagggtgaggagggcaatccatttcattccccttctcgcgggactcggcattctagctggtacgggaaccggaattgctggaatcacaaaagcttccctcacctatagccagctctcaaaggaaatagccaacaacattgacaccatggctaaagccttaacgaccatgcaagaacaaatcgactctttagcagccgtagtccttcaaaatcgtcgaggactagacatgttaacggcagcacagggaggaatttgtttggccttagatgaaaaatgttgcttttgggtaaatcaatcaggaaaagtacaagacaacatcagacaactcctaaatcaagcctccagtttacgggaacgagccactcagggttggttaaattgggaaggaacttggaaatggttctcttgggttcttccccttacaggcccacttgttagtctcctacttttgctcctttttggtccatgtctcctaaatctaataacccaatttgtctcctctcgccttcaggccataaagctccagacgaatctcagtgcaggacgccatcctcgcaatattcaagagtcacccttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: