Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SYNE2-spectrin repeat containing, nuclear envelope 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SYNE2-spectrin repeat containing, nuclear envelope 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042134 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SYNE2 |
| Origin species: | Human |
| Product name: | SYNE2-spectrin repeat containing, nuclear envelope 2 Gene |
| Size: | 2ug |
| Accessions: | BC042134 |
| Gene id: | 23224 |
| Gene description: | spectrin repeat containing, nuclear envelope 2 |
| Synonyms: | EDMD5; NUA; NUANCE; Nesp2; Nesprin-2; SYNE-2; TROPH; nesprin 2; nuclear envelope spectrin repeat protein 2; nucleus and actin connecting element protein; polytrophin; spectrin repeat containing, nuclear envelope 2; synaptic nuclear envelope protein 2; synaptic nuclei expressed gene 2; spectrin repeat containing nuclear envelope protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatctagtcctgagcttcccaccgaagatgaacagggttcctggggcatcgacgatctccatatttcattgcaagctgaacaggaagacacccagaagaaagccttcacgtgctggataaactcacagttggccaggcacacttctccctcagttatatccgacctattcacagacattaaaaaggggcatgtcctcctggatctgctagaagtactttctgggcaacagttgcctcgggataaaggatctaataccttccagtgtagaatcaatatagaacatgccttgacattcctaagaaaccgatcaattaagctaataaatattcatgttactgatatcattgatggaaacccatccattatccttggcctaatttggacaattatcctgcactttcatattgagaagcttgcccagactctttcttgcaattacaatcagccttccctggatgatgtgagtgtggttgactcatctcctgcctcaagtcctccagctaagaaatgctctaaagtgcaagcaagatggcaaatgtctgcaagaaaggcccttcttttgtgggctcaggaacaatgcgccacctatgagtctgtcaatgtgaccgattttaagtcaagttggagaaatgggatggcttttttggccatcattcatgccttgcgaccagacctaattgacatgaagagtgtgaagcatagatccaacaaagacaatctgagagaggccttcagaattgcagaacaagaattaaaaatccccagattgctggaaccagaagatgcctggagaagttctgcactttacagaatttatatgcctggcacagtgtcttgtgccagctacttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ferritin, heavy polypeptide-like 3 pseudogene - protein tyrosine phosphatase, receptor type, F - ClpB caseinolytic peptidase B homolog (E. coli) - DnaJ (Hsp40) homolog, subfamily C, member 11 |