Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CLPB-ClpB caseinolytic peptidase B homolog (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLPB-ClpB caseinolytic peptidase B homolog (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006257 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLPB |
| Origin species: | Human |
| Product name: | CLPB-ClpB caseinolytic peptidase B homolog (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC006257 |
| Gene id: | 81570 |
| Gene description: | ClpB caseinolytic peptidase B homolog (E. coli) |
| Synonyms: | ClpB homolog, mitochondrial AAA ATPase chaperonin; ClpB caseinolytic peptidase B homolog; ANKCLB; HSP78; MEGCANN; MGCA7; SKD3; caseinolytic peptidase B protein homolog; ankyrin-repeat containing bacterial clp fusion; suppressor of potassium transport defect 3; testicular secretory protein Li 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctaaaaagttggtacttgcttgtttccacacagggcttcatcaggctggacatgtccgagttccaggagcgacacgaggtggccaagtttattgggtctccaccaggctacgttggccatgaggagggtggccagctgaccaagaagttgaagcagtgccccaatgctgtggtgctctttgatgaagtagacaaggcccatccagatgtgctcaccatcatgctgcagctgtttgatgagggccggctgacagatggaaaagggaagaccattgattgcaaggacgccatcttcatcatgacctccaatgtggccagcgacgagatcgcacagcacgcgctgcagctgaggcaggaagctttggagatgagccgtaaccgtattgccgaaaacctgggggatgtccagataagtgacaagatcaccatctcaaagaacttcaaggagaatgtgattcgccctatcctgaaagctcacttccggagggatgagtttctgggacggatcaatgagatcgtctacttcctccccttctgccactcggagctcatccaactcgtcaacaaggaactaaacttctgggccaagagagccaagcaaaggcacaacatcacgctgctctgggaccgcgaggtggcagatgtgctggtcgacggctacaatgtgcactatggcgcccgctccatcaaacatgaggtagaacgccgtgtggtgaaccagctggcagcagcctatgagcaggacctgctgccagggggctgtactttgcgcatcacggtggaggactcagacaagcagctactcaaaagcccagaactgccctcaccccaggctgagaagcgcctccccaagctgcgtctggagatcatcgacaaggacagcaagactcgcagactggacatccgggcaccactgcaccctgagaaggtgtgcaacaccatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 11 - alanine-glyoxylate aminotransferase 2-like 1 - meningioma expressed antigen 5 (hyaluronidase) - dihydrouridine synthase 1-like (S. cerevisiae) |