Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NEK2-NIMA (never in mitosis gene a)-related kinase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NEK2-NIMA (never in mitosis gene a)-related kinase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NEK2 |
| Origin species: | Human |
| Product name: | NEK2-NIMA (never in mitosis gene a)-related kinase 2 Gene |
| Size: | 2ug |
| Accessions: | BC065932 |
| Gene id: | 4751 |
| Gene description: | NIMA (never in mitosis gene a)-related kinase 2 |
| Synonyms: | serine/threonine-protein kinase Nek2; HsPK21; NEK2A; NLK1; PPP1R111; RP67; NIMA (never in mitosis gene a)-related kinase 2; nimA-like protein kinase 1; nimA-related protein kinase 2; protein phosphatase 1, regulatory subunit 111; NIMA related kinase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccttcccgggctgaggactatgaagtgttgtacaccattggcacaggctcctacggccgctgccagaagatccggaggaagagtgatggcaagatattagtttggaaagaacttgactatggctccatgacagaagctgagaaacagatgcttgtttctgaagtgaatttgcttcgtgaactgaaacatccaaacatcgttcgttactatgatcggattattgaccggaccaatacaacactgtacattgtaatggaatattgtgaaggaggggatctggctagtgtaattacaaagggaaccaaggaaaggcaatacttagatgaagagtttgttcttcgagtgatgactcagttgactctggccctgaaggaatgccacagacgaagtgatggtggtcataccgtattgcatcgggatctgaaaccagccaatgttttcctggatggcaagcaaaacgtcaagcttggagactttgggctagctagaatattaaaccacgacacgagttttgcaaaaacatttgttggcacaccttattacatgtctcctgaacaaatgaatcgcatgtcctacaatgagaaatcagatatctggtcattgggctgcttgctgtatgagttatgtgcattaatcttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HERV-FRD provirus ancestral Env polyprotein - mannose-6-phosphate receptor (cation dependent) - spectrin repeat containing, nuclear envelope 2 - ferritin, heavy polypeptide-like 3 pseudogene |